Description :
From Genome Similarity Track
Location :
scaffold_3:57234- 59980
Transcript NameFunction/comments
g6079.t1 hypothetical protein PHYSODRAFT_500307

Sequence
2746 bases(100 bases per row)
ACGTCGCAGTACACGTGGTGGAGCTTCGTGCCTGTGTTCCTGTACCTGACGTTCCAGAAGACGGCCAATCTGTACTTCCTGCTCATTGGCATTTTCCAGA
TCATCCCGTCCGTCTCGCCGACGGACGGCGTGCCGCTTCAGTTTATCCCTCTGGCTATTGTGATTATCATTGACGCCATCTTCGCTGGCTACGAAGACTA
CAAACGGTACATGGCCGACGACCTCGCCAACTCGGCCAAGACGCGCGTGTTTAACCGCCAACTGCGCGAGTTCGAGGAAGTCGAGTGGCGCGAGGTGAAG
GTGGGTGACTTTGTCAAAGTTGCCAACCACGAGATCTTGCCGGCGGATATCATGATTATGGCGGTAATTCCTGCGGAAGGAGCACGCTCTGGTGGAAACA
TGGGGCTCTGCTACGTCGAGACGAAGAACCTCGACGGCGAAACCAACCTGAAGCTGCGGGAAGCACCTCAGCCCACCCGCAATGTTTTCATGAACGAGGA
TGAAGCCGGGTTCATTGTTCAAGGTTACGTCGAGAGTGAACTCCCGAACGGAGATATCAACCAGTACTCGGGTACGATGTACTTGGAGGAGAACCCGAAT
GGAGGGAGCGCTGAGGGAGTCCCTCTTTCGCTGAAGAACATGCTGCTCCGCGGCAGTAAGCTGCGAAACACCAGTTACGTGTATGGCTTGGTGGTGAACA
CGGGTGTGGACACCAAGATTATGATGAGCTCTGGCGATGAGTTCCCCGTGAAGGTCTCGTCTATTGACGAGATGACCAACAAACAAGTGATCGTCGTTGT
TGTGATTTTGATTCTGATGTCGCTCGTCGGTGCCATCGGAGACAGGTTGTGGATGGATGGTCTCAACGTGCCGGAGTATTTGCATTTGGACGGCTGGGAT
GACAGCTTTATCGAGACGTTTGTATACTTCTTCACGACGCTCGCCTCAATGGTGCCTATCACGCTCTACGTGTCTATCACTCTCGTGAAGGCCTTGCAAG
GGTATTTCATGGAGCGCGATCTTGACATGTACGACGAAGAAAGTGGCACGCCGGTGAAGGTTCGCAACATGCAGCTGAACGAGCAGCTAGGTCAGATCTC
TCACATTTTCTCGGACAAGACGGGCACGCTTACTTGCAACAAAATGGAGTTCCGTAAGTGCAGTATTGGCGGCCGAAGCTACGGCAAGGGTACTACGGCC
ATTGGCATTGCTGCGCGCATGCGTAGTGATTTTAAGGGCCAACCTATCGATGAAGAATCGGCAAATGAGAACGACGCAGATGCACGCGTCGAGGTCCCGG
TCCCCAACGTCAATTTTAAGGACAAGACAATGTGGCGGGACATAGAAAACAAGGACGACCCTCAAAATGAAAAGATTGAGGAGTTTCTCACTCTGCTGGC
GTTGTGCCACGGTGTCCTGATCGAGCGCCTGGACCCAACGGAAGAGGATACCAGTCCGCCTATTCACTACTCAGCTTCATCCCCAGATGAGCTCGCACTT
GTTTGTGGTGCTAAGTTCTTTGGTTACGAGTTTATCGAGCGCGAACCGGGAAGTGTTTCTATCAAGAAACCCGATGGCGTCGTGGATCAGTATGATATCC
TAGAGGTTTTCGAGTTCGACTCCAACCGCAAGCGTATGTCAGTTATAGTTCAGCGACGAAAGCGTGACGATGAGCTGCGTCAGATGTCTGAAAGCGAGGA
AGATGACGTTCTGCTTCTCACAAAGGGAGCTGACAGCATGCTGTTTCCTCGACTCGCCCCGATGTCGGCTAACAACCAACGAATCCGCGAGTCTACCGAG
AAGCACCTAGAAACGTTTGCTCAAGATGGGTTGCGTACGCTGGTCGTGTGTGCAAAGCGAATCGATCCCCGCGCGTGGGAGGACTTTAACGCACGGTATC
GTCATGTTTCTGCAGACCTCAGCGAAGTGGAGGCCAAGTCTCGTGGAGAGCCCAATGCTCTTGACAGACTTCAGGACGAGATGGAGTCAAACCTGGAGCT
GCTTGGTGCGACTGCAATTGAAGATCGACTGCAGGATGGCGTGCCTGAAACGATGGAGAGCCTTGCTAAGGCTGGGATCTGTATTTGGGTATTGACTGGA
GACATGGAGGAGACAGCGATCAACATCGGCTACGCTTGTCGCTTGCTGAACAATGACATGGAACGACACGTGATCAATGCGGCAAAGTATCGCACGAAGG
GCTCGATCCTACGAAGGCTCGACAAGATTTTCCACTCCATTCACGATGCCACTGATGACGCTTCTCGCACGTCAACTGTTGCCGCCCACTCCGTCTTGTC
GCCACCGTCGGGTGAAATTGAGCACGCGCTGGTTATCGATGGTGCATCACTGAATATGATTCTGGAAGACCCGCTGCACAACTTGCATCTCCTGCGTGTA
GCACTGCTATGCAAGGTCGTGGTTGCATGCCGTGTGTCGCCTCAGCAGAAGGCACAGCTGGTGGAGCTAGTAAAGTTGAACGTTCCGGAGTCTCACACTC
TTTCCATCGGTGATGGCGCCAACGACGTTCCAATGATCCAGAGCGCTCACATTGGTGTTGGCATTAGTGGACAGGAGGGTTTGCAAGCTGTGAACAGCTC
GGATTACGCGCTGGGTCAATTCCGGTTCCTGAGTAACTTGATTTTGGTTCACGGTCGATGGAACTACAACCGAGTTGCTGCGCTTGTCGTCTACACGTTT
TACAAGAACATTGCGTACAATGTGTCCATGTTTTGGTACACGCTGT