Description :
From Genome Similarity Track
Location :
Scaffold_27:572321- 573893
Transcript NameFunction/comments
Phyca_LT1534115111adenylate kinase, putative

Sequence
1572 bases(100 bases per row)
ccggatccaacgcctgcagaacgcaatgagatcgaaccgcctggggaacccacttttccctttggcccaatgtctatcgtgaaatttatgaacggatatc
actcgtacgtggagcgcatgcagctcgaactctccacgtatcgagcaactaacgctccaatctaccacctcgtagtggttctggcaactcaatcactcaa
tgtaatccgagaccactgcattcaggcaatcactggggtaaggagccttgtttctcgtccacaaccattctctaacttctgtgcttccagactactgtcg
gtttgtcgcggtttagtgtctcgcgtgaagcttgtctgatctccctacccgaggatttaactggttccagtcgtagtgaaaaagtcaagtggttgcttta
tggagactggagtacgcttcttgaggccgaagcaaatggcacgtcggagtcattcgcacgcctgcctaaacgtgatgtcaaacgccgtcttttatcaaag
tggcgcgagttttgccccgttctgtcgacttcaactaacgcactgagactcggcgagcctgagtttgctgtttgctattccggacgagtctatcttctca
catcccaagccgcccaacgagacttctgtgcccacccacttcagtatttgcgccgagatattccagtaccatccacgcgtcgaacgttttggctcattag
cactggggctagcgagatcctcacaccttcatacttagaggcacttgcaaatggactccatgtgcagacagtctctccttcgaagttactcaagacttcg
ccacctatctccatggaaatgaggctcatgggtggacagatcgtctctcaaactgaagctgcagcagttgcagctgaggcgatcaagtcaaaactgaaca
agcccaccgggtggatgatcaccgatctgccattgacgcgcgaggttgccgctgtgttgcttgaacacggttgtgtgccagacgtgattctcgtgatgga
cgaagaggatgaaagtacaaactccgacgcgttatccgtgctgcggcgccagcaattccaggctgagaaggctggtgcggaggaaattgtactagggctt
ggcagagctcctcacgtcataacttgcccgctatatcagcaaccgggagattcactggcagcaattgaacgagaactcaatccagtagctcctcgcgtgg
acagagtcgaagatgggcatgttccagagctggtagatgaatacgatccagtcatgattttcgctccaccagttccagagaaagaaggcataaagtcgtc
agtggaggaagaagcctcagatcctgaggtggaagcacaagccgaagcagcgagaaccagagccatccaacttcaaggagagtgtggacatttctgccct
gtgtcttggagtacgcgtggtttgctgattcctggattgccatcaagtgtttgttcgtttcgacagaagttttacgctttcgctggcgagtcagagaaac
gtacgtttgaacggaatccaagtgccttcattccccaacacccatgcgcgaccgcgagcttagtcccctgtg