Description :
From Genome Similarity Track
Location :
Scaffold_29:572316- 591394
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12087aldo/keto reductase family protein
Phypa_INRA-310PPTG_12088pyruvate dehydrogenase
Phypa_INRA-310PPTG_12089pyruvate dehydrogenase
Phypa_INRA-310PPTG_12090hypothetical protein
Phypa_INRA-310PPTG_12091hypothetical protein

Sequence
19078 bases(100 bases per row)
AACGTCCTTGCCGCCGACTTGTACCTCTAGCCCGCTGTACCACCATCTGCCACTTGTCGTGCCCGATTGACTACTAGTGCACTTCGTGCGTCCGTTATAC
TCACTCGCACTCGTCGGTAAGATCGATCACCACCGTATACTGTTGCGTTTCGACCGGCTCGGGTTTCAAGGGCACCAAATGCCTACACGCCATCCCCAGC
CCGAAGATTGTCCCCGATCTTTCCTCCGTCAAAGAGCGTTTCAAACTCGCCGCTGGTGAGCCATATACGCGACACAAGGCCGCCGGGTTCACGCTGGAAC
TCCACCTCGTGCTGGGTCTCATATCGCCCGGCTCGGTTGCGGACCTTGCGCTGTCCCCTTTCAACAATTGTGCCTGCGGTAGCGGTCTGTAGTAAGTCAT
CAATGGTCGGCAGTCTACGTACTTGTCCACATACTCGAAGTGCTCGAGTAACCCCACCGCCGTCATGGCCATTCGATCCTCCTTGTCGTCCCGGACTTGG
GAGCCGTATGGCACCTATATCGACCCGTTTTCTTTCCTTAGAGCGTTCGTCAAGGCCTGCGGTCTCCTCACCGCCTGGTAGCCGGCTATCTGTAACTGGA
TCCACTTCTTCGCGGGCTGAAGCTTCCGACTGGTGATGTAAAGCGTCCCGACGAGCTGCTCTCGCTTCGCGGGCTTCTTTCCCCGCGCGTTGCTTCGCCT
GCTGCTCTTCTTGGCCATCTGGCCGCGTCTCGGTAATAGTGTTCCTTCTTCGATACTTCAGGCGTCGTGAGGGCCGGTCTCGGGCTGACGTGCGACTGAG
CTACCATATCCTTCCAGACTTTGTGGAACCTTTCGACTAGCCCCAGCAGCATAGGTCGGTAGGGTACGGGTGTGGTCTGTCGAGCTTGCAGTAATTGTAC
CAGTTTCGTCACTATGAGCCCATTCAATTCCGGAGCTCCGTCCATGAGGATTTCCCGCATAGGTCCGTACACTAGAACCACTCGTTCAGCGATGAAACGC
GCAACGTCCTCGGCCGTGTGGGCAGATACTGCTACTGTTACTGCATATCTGCTGGCGTAGTCAATTGCGGCTATAACATATCGATTCCCCCTCGAGGTGA
CTGGCAAGGGTCCAGCGATGTCCACGGCCCACCGATCACTCACGTCACCGACTCCCTGACTCCGCAGTGGCGGAATGACAGCCTTTGGCTGCGTTTTCCG
CGTAGCACAATCCCGACAACTACGAACCCAATGCTTCACCTGGTCCCTCATGTCCGGCCACCAGTACGTTCGTTCTAGTCGCGTGTAAGTCTGAGGAGTT
CGCAGATGGCAGGCGTAGATAGAATCGTGCGCTTCCCTCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTTTTTCTACGACTGAATGTTTGACGTAAAAAAGAGTCTGAATGGATACACTTTTCGCGATCGCTGATTCGCTGATTTGTGGTTTTTGTTTGCA
CGATTTTGATTGGCTAATAAAAATGTTGTTTCAGTGTTGTTTCGGGGAAAGAAGTAACAATACTTTGCATGTACACCATAATTAGATCCCGTAAATAGGG
GCGAATCCGTTTCCAAGCACCCATTTTCCAATGAGTGCGTTGGTCAAGACCAAGCTGCTCCCTAGTGGTCATTCCATCCCTTCTGTCGCATTGGGCGTGT
ACCAGAGCGCTCCTGGTTCCGAGACGTACGACGCCGTGCTCGCTGCTCTCAAGCTCGGGTACCGCCACATCGACACTGCCACCGTCTACCGCAACGAATC
GGATGTGGGTAAAGCCATTCGGGACTCGGGGATCCCCCGCAACGAAATCTTCGTAACCAGCAAAATTGTCGCCTCCCGCACCCGATGGAACTACGATGAG
GTGGTGGAAGGGGTTCGTTTGAGCAACCGCAAGCTCGGACTCGAGTACATTGACCTGTATCTACTGCACGCCCCCTTTGACAGTACTACACGTGCTGAAG
CCTGGAAGGCACTTGAAGATATGCAGACGGAGGGGATTTTGCGTGACATTGGCGTGTCCAACTTTGGCGAGCTGCATCTGCAAAGGCTGGCGGAGACGTG
GCGTGTAAAGCCTGCGGTGAACCAGGTGGAGCTGCATCCGTGGTTGGCTCGTGCCGATACAGTCAAGTACTGCGAGGAGCAGGGAATTATCATGGAGGCG
TATTCACCTTTGGCTCGTGCTCAGAAGATGCATGACCGTACGCTGAAGCTGATTGCGAGTGAGGTGGGTGCTACTTAGGCCCAAGTCTTGATCGCGTGGA
GTCTGGCAAAGGGCTTCGTGGCTCTACCGAAGTCAGTGACCGAGTCCAGAATTAAGGAGAATCTGGAGGCTGCCAAGTTGGAGCTCACGAGTGAGCAGAT
GGAAAAGTTAAACGGCTTGGACGCGTACTTTGTGACGGCATGGGACCCGATCAAGGACCACGCTGTGTAAAAAGTGAAATCTACTACCACGTTGACACTA
CCCGCTACTATATCCTGACTTGTTAGCAATGCTTCATGCACAATGCCAATACGTATGTTAAGCATTATTTGGCGTCTAAATTACGAATAGAGTGGCGGGA
GGTTGAAGGACGCATGACCAGGGACGACTTCTGTGTTGGTTCCAAGGCGATGAGCCTGAATGAACCCAGTCGACCCGGAGCCCTCGAGCGAGCTAAAAGT
GATTTCACCTCCGAAATAGCGTGCAAATAACCTTGCCATCGGCAGTCCATAGCCACCTCCACTAAAGTGTTGCCTGTAGGCTGCATTGGAGTCGATAGGT
GGGCAAGGAGCGCTTGTGGTGTAGTCGTAGTGCCACAACTTATTCCAGCGACTGCGTGGAATACCTCCGCCCTCGTCACTGACCTTGATGGTCAGATCCT
CACTGCCCACGCAAATTACGATTTCCACTGGCGGTAGTTCTCCTCCAAGCTTGTATTTACTAACGTCAGGGAATATCTTGACACCAGAAACGTCTTCAAC
CTGCACAAAGAACTTAGTGAGCACAAAATAGAAGCTTCACATGCGATCCATACTAGTCACATACCGAAGGAAGGAAGAATCCCAAGGACGGACTGTCCGG
GTTCATTACTTGCTTGAAATGGTTGAGTTCACCTGGGGCTTTGCCAATCCTCTTTTTGTGGTACTCTACCGTCGCACGCATGGCATTCTTCACGAGCTCG
AAGACCTAAATGAAAACATGTCGTTGTCTGTTACACCTCGTTGAGTACACCGGATACTGCATTACATACCATGTGGTGCAGATGTGACCGCACATACATC
AACGGTGTACTAGCACTTGCTGTCGCGTGGATCTCCACTGGCGGAGCCTCACCGCAGTACTGGACACACAAATTTGTGGCTCGATCGCATGCCTCACGCA
CGATTTCCTCGACGTTTATAAGATGAACACGTCCTCCTGGGTGCTCGAGTGACTCCACGTGCTGACCAATGAGCATGCGGATGCCGATACGCCCCAGGAA
AAACTTGTCCAGTCGGCTCTTGATGTCCTCCTGCGCGCTCTCAATTTGCAAGGCACTGTGTCCGAGATCCGTAGCCTTGAGTTGTTGAAGACCATAACAG
ATCAGCGGCACCAAGTTGGAGCCGCGTGCCTTGGCTTGACGCAGCGTGTCTGTGAACAATCGGTCCTCCGCCTGCCAACAAGCTCAAAGCAAGTCAGATC
TTAGTCATTAATCCATCTCCACGTCTTCTTCTTACGACAGTGGCTGGTGGTTTTGTAGAGTTGATCCACTGCAGTTCTCGTCGGTAGACGTCGATGGCTT
GACGGATGGACGCAGTGTCGCTCAGCCCCAGTGGTAGCTCCGAGAGCTCCACAATAGCACTAAACATCCACAAAAAACACGGTAAGAGCTACTATAAACT
GCATAACAGATGGAAAGCGCGCAATACACGGCAATAATCATGATTTTGGTGAAAGGGTCATGGTCTTCTTACCGAGCGAAGCGAGACTGCAGCTCCTTGT
GCAGGAACTTGGCCGATACAATGTGCAGCTTGGCGCCACCATCGGCAAACGATCGCATCTGCTGCAAAGACAGAGGCGTGGGCTCCGTGTCGGCGATCTC
GCGCACCTGGTCCATGGGAATGGGCGTCTCGTAGCTACAGATAACACAAGAGTACCACCGAAATGTCAAAAACCATTACGAAAAGTATCATATTGAGATC
CAATTACAAACAAGCGTACAGTTCAGAGGTAGAATGGTGGCTCTGCATGCAGCGCACGTGGTGCGTTCTACCCAGAGCCGTGGCCAGGGGCGCGAAGCTG
CCGCCGCGACGCAACATGGTCTCACGTTCGCTGGGCTATTCCCGTTGTGAGCGTTGCGCAAGCACTTCAGCTTCATGCAAATCTGTTGCGCGCTGATTGG
TCGATACAGGGCCACAAGAATGTGCTCCACACAAGTTCAATACAGACAGAACCAGGGCAATGGGGACCATTTTAGAGCGAGCTTTGGCCCCGGCACAAGC
TGCCAATGTCGACTACCCTTGTAGCAAGTTAACTTAGCTGTGGGTGTTGCTGAGCTCGACAGTACTCATGCTCGCTGGAGACGAAAGTCTCTCCTCTCGG
ACGGAAACTCGTGCATCAAAACAAGTGATTGGTCGCGTGGAGACATGAAGTGTAACCATGTTGAAGCGCCCACCGAAACGCAAGCGGCAGCTCTGGCTAC
AACGTACATTGCATCGAATAGTCATAGGAAACTACTACCTGTATATGGTTCGTTGTACAGGTAGTGGGCAGCACACGTCGGTGCTCATTGTCAAGTTGAC
GCTGGGCTATCGTTGGCAGTGACGCCGATTCGTCGCGCGTCGAGCTTCAGCGTTCCGGTGGTCGGCAGCGTCGATTAATGTTAGCGACAAAGCCATGGCG
TTGTTAACCTGCGAGGTACGTTGTATCCACAGACCAAGAAAGAATCCGTGCGAGCCGCAACTTGGGACTCCCAAGGCGGAGCGCCTGAATGAACTTTATT
GAGTAGTGTTGAAGGTGGTATATCCCCATATTATATGGGGATTTTTTATTGGCGATCTACCGAGCGGGACAGTTCCATGTGAACTCCATTGCCGTCACTA
ATTGATAGCCAGAGTTAAAGTTCAAAATTATCTCGAAGCAGGCTATTCCATTTTACCGCCGTATCGATGAACCAAATCCAGTGCGCCGCCCTCAATTCAT
GTACCCGTTGAACATCTTTGATAAAAGCTAACCCGAGCTTCTGGAATGGTTCCAAAAGATATTATCTCGACAAATTAGGTTTTCAGGGCGTCTTGTACCA
GCTCGATAGGTACTGAAGAGCTCTTGTAAACGGAAGACATCGTAACAAATGTCGGTGAGTCCCGTAGGTAGTCTGGAAAAGCTCGTTGATTACATGTTAA
CACCGTGGTGGCACTACATGTACTACATGTAGTCGATGAAGAGTAATATTCGCACACCAAATTCTCAATAAATATCTAAACCAGATCGCACAGGCCTCGA
AGTTGTTTCTGCTTTTCACTCATGACACTAAGTTAGCTGTTCTCCAGGAAGAGCGATCGAATGTGTGCCTGCAGACAAGGTTCGTGTTCGCCATCGTGAG
TGCCAACTACTTGTCACAGAAAGCGGCAGGTGTCCGCAGTGTGGCAGACTCCGCATGCATTCTATCTGGACATCTTGCGAGGCGACTTCAGATACCTTCA
CTGCATTTTTGGCTGAGCAATCGACGTGGAGCAGAAGCAGCCTGGTGACATAGACTTTAAGTCAATGTGCAGACAACCTGCGTGCCGATGCATGCATGCC
CATTCTCGTGAGTATGCAATACCATGCGAGAGGCTCCCACAAATTCGAGAGCCGAGGCGATCTATATGTACACATGTTATATCTGTTGCATATACTTTAC
ATATTAGCGTCCTCAACGCTACTTATTGCTTGCCGGTAAACGAGTGCCGTCTTCATCGTACCAGGCAGATTAATTTAGGCAACGGAGACGGCAAACAATT
TAGATACAATTCTTTGTCAAACGAAAGTGGCGCTACGATTGTGAACGCGCGTTTTCTTGTGGCACCGCCAGCGTCGTACTATCGTCAGGTCCGATTTGCA
ACAATGACAAACCCTTTCGAAATAAGTATTTGAGAATCGAAAACTTGGCTCAATTTCTTCAAATCATTCCCATACCCTGCATATTTCGATTCATTACTGA
ACATTTAATTAGTATCATCTACAGTACGAACTCGCGACAAGAATAATAACAGCGAGAGACACGCAACAAATCCAAGCAGAAAACAGTGAGCTACTTTCGA
GTTCACAATTCAATTTGACCCCAACACCTCAAACGACAATGGAACTTGTCAGGCGTAGTGCCAACCCCCATCTCTTATCAGGCGTGCTATCCACGGTCGC
CAAGACTGCCGTGGCACGCCACGGTGCTGCACTGCTGCACATGGACGCTTTTCGTGCGGACTTCGAGGCCAACGCCATCTCCATGGACGAGGTGCGCGAA
ATTGCCCACAACGACCCCACGCCCATGTCTCTCCAGCAGATGCGCACGTTCGCTGATGGTAGCACTAAGCTGCGTCTTGTGGCGGCCAAGTTCGTGCACA
AGGAGCTGCAGTCGAGGTACGCACGAGCCATCATGGAGCTGTCCGACTTGCCCATGGGTCTGAGCGAGACCACGTCCGTGCGCCACGCTATCAACTTCTA
TCGCTATGAACTGCAAAGTATCAATCGCATGAAGTCGCCCACAAATGCCGCAGAGGACCTGGTATTCACACAGAAGATCCGCAACGCCAAGGAGCGCGGC
TCGAACCTCGTGCCGCTCATCTGCTACGGTCTCCAGGAACTTAAGGCCACGGATCTGGGCCAGAGTGCACTGCAGCTGGAAAGCGTGCAGGAGGACATCA
AGGACCGATTGGACAAGTTCTTCCTTGGTCGCATTGGTATCCGCATGATCATCGGACACCACGTCGAGTCGCTGGAGCACACTGGTGGCCGTGTGCATTT
GGTTAATGCCGAGCAGGTCGTCCGTGATGCGTGTGAACAAGCACGGAGACTATGCGTGCAATACTGTGGTGCGGCACCTCTCATTCAGATTCGTGTGACT
CCCAGCACCAATATGCCTTTCATGTATGTCGAATCGCACCTTCACCACATGGTCTTCGAGTTGGTCAAGAACTCGATGCGTGCCACAGTGGAGCACCACC
GTTCTCGGTTTCAGCTTCCGCCACAAGGCAAAATGAACCGCTTCGAGCGTGTAATGAACCCGAAGAGTCCGTCGCTGGACTTCTACATCCCGTCTGTTGA
GGAGGTCGCGGGAGTCAAGGTTTACCCGGATGTGAGCAAATACCGGTCAGGCGACGAACTTCCCCCCGTGGAGATTGTGATCTGCCAAGGCAGTGAAGAC
CTGACCGTCAAGGTCAGTGACGAGGGTGGAGGCGTTCCACGTAGTCGCTGGAATAAGCTGTGGCACTACGACTACACCACTAGTCTGTTGTGCCCACCTA
TTAACTCGGACAACTACCCAACGTACTGCGAGCACTTCAGTGGGGGCGGCTACGGTTTGCCAATTGCAAGACTGTTCGCTCGCTACTTTGGTGGAGACGT
CGTTTTCAGTTCACAAGAGGGCTCTGGTTCGACAGCGTTTATCCAAGCACACCGCCTGGGAACGAACATGGAACGGGTCCCCCGCTGGAAAAGGATGCAG
CCGTCAACTTCATCACCTCCTCGCTGGCAGATTCATCGTTCAAACGCATGAGCTTGGCAAATCGCCAGTAGAATGTATCCGCTCGTATTTTATTATCAAT
GGACAGTATTAACTTAAACGCTTAAAATATTCCATGTTTTCGATTCTTTTGGCGTATCCTGTGTCGAAGCTTGCTTGGAGCTGGAAAGCGCAAGGTGCAC
TACCAGCGAATGAGGTGCAATATTACATATATTAACCGCCGGAGCAGTGTGACTTGATAAAGCTACTGAAGGTTTCATTCAATTTGCGACTGGGATTGGT
ATTAAATGCTATGATTACTTCGGGCATTGATTAGTATGGAGCAGCGTCTGTGGGGCGAAGAGCGCGTTCAGCATTTACCATGGTTTGTCAGACCTGCACC
TAGAGACTATCACTTGTCCGCCTGGTACAATACGAGCTGAAGGGTATTATTAATCGCCGCAGCAGAGAAAGTATCCTTTGCACTCCTTACAGCGCTTCTG
GAGTGTAGTGCGGTTTGTCCAGACATGTATTTCGAAGTAGAATGGCTTTGCTCCAAGTACAACAAGGAGCTGTTGGTGACATGATGGAACAAAAGAGCAA
GACTGGTAGGTGCACCTAACGTAGATCAGCAGATTGCAATTAGATGATGTAGGAGAGACATGGTCTATTTCATTTGCAGGAGAAATTCTTAAAATTCGTA
CTGGAAAGAGTTTTGTTATTAATATCAATGCAAGCCTTTTGCACAGCCACAAGGTGAAATGCCGTCGATTTTTTTGCACGTGTGGCCCACTACATCATGT
AGTACATGCAAAAGCAATGGCATTTTCTATGAACGAGGATAGAAATGACCCGAACTCCATACTTGTTGTCGTTTGCGGAGAGCAAGTTGCCTATTGTGAC
GTTGCAGTAGACTTTGTCTTCATTGGCTGGAAATATGTAACGTGGACACTCCGACAGCAAACCACACCCTTGTCATAGTGACTAGGACACTTATTCTAGG
ACAGGATTGTTGGGTACATTTTGAGTTGCATTCGTTTTGTCCCTCTTATCTTCGATTCTTATCTGAACACGCCATTAACAAATCGGAACGTGTTGCTGCA
CAAGTGATTTTTGCGGCATCGCCATGTTCGTGACGTCTGCACCGCTTTCGGACGGCGCCAAATTCAGCGAGGAGGCGGCGGAGATCGAGCGATTCCGCGC
TCGTCACCGCCGCATGTGTCGCGGGCAGCAACAGAACGCTTCGACAACTTCAACAACTGAAGCGCTGGACGTCGACGGCGGACGTACACGCAAAATCTCG
GCAAAGTGGCGTCAGAAGCAGCTGCATCGCAATCAAATCGAGGATGGCGCGTGGCCTCAATCAGCAGGCACCGAAATGCACTTATGCTTCAATGCGTTCG
ACTTCTCGTCGTCGCCCGAAGCCTTTTACGAGGAGGAACCAGTTGAGACCACATCCGAGCCGGTTGAAGAGGAGGAGAAACGTAGATTGCATATGGCTGA
GGTGGCGAAGCAAGTGACGGCCATGGGCTTCAACAGTGCCAGTCTGTGGGAACAGAGCTTCCCGGGTCTTCGACAGCTATTCGCCAGCTGCCGACTTTCG
GGCAGAATTCCGTGATGCAGAGTCCCCAGTGCAATACACTGCACATGACATCGAGCAGCAAGCGCTGTAACAACCACGACACCATGCGTAGAGTTGAGAA
AATGTTAGTAGAATAGTAAATGAATAATACTCTAAATCCCACAAGTAAGTTTGAATTTTACGTGATTCGTGTGCGTTGCTGTTGCTAGACTAATGATTTG
CAGGCCATCGAAGTTTCGCGTGATTGTAAGAGATCCTGAACACTCACTATCAGCGTCTCTTCTAGTTTATAATGGCGAGTGTTGCAAATACGACGAAGGC
TTGAGCTGGGCCAACGACCACGGAGTCGTCCAGTGGGTGACTTCGTAAAAAACAAAATGAAAATTGTTGTCTGCATTGTGTAGGTGAAACTGCCTTGTGG
GCATGAATCTGTGCGGTGTGTAAGGCAGGAGTTCATGGACAGCGCCTGTACTCCAGAATGAAATTCTGCCGTAAAATCGGTCGGTGGTGCTCTGAGTTAG
TTTATTGCTCTGCCTACTTTCTTAAAGGTCGACTGACTCGTGTACAATTTCTCAAAAAGCGGCAATGTGCCCCGGGTGATACTTAACCCTTTCACTACCA
GCCAAATCCGGCGAGCTTACATGTCCGCAGTAGACCTCTAACAGCGGTGCAGGCTTTCAGTCATTGGCTAATTTTCTCTCAACGAGGGTAAGGCGTCCAG
CTCACCAAGACTAACAGGTCCGCAGCGGACCTCTACCAAACACAGAACCGTGAAGACCACAATAATAAGAGGTCCTCTACCGCACACATTTCGCTGTCTA
TCCGCAAATTTGCGATCTATCAGCACTTTTGCATTCTACCTGCAGTCAAGATGGACATCGCCGTGCTGCTGAACGCCGACGATGGCGCTGACACTGACTG
GTGCTTTAAGGTTTCTGATACAGAGGAAGGGGAACCCAACGGGACCGAAGGTGCGGAGGGCGATGACGTATTCAACAGCGAGTCCACTGCAGGTGCGCTA
CCACCAGGGGAGAGGCGAACTGGCAACGCGTACGTGGATGGCATCATTCATGACAGCGGTCTGCATATAATTCGCGAGGGGCAGGTGAAAGCTGCCTACG
AGGAGCGAGGAGAGCTCGGGCTCTTCTCCTTGTTCTTTACCAGAGAATTTCGGGACTCGTTGCACAGGTGGACGAACGAAATGCTCAAAGAGAAAGGAAA
GCCTGAGGCAACAGTGTGCGAGCTTGATGCTTATATTGGCCTAGAGATTGCGATGAGTTTCAACCCTGTGACCGAGATCAAGGAGTTATGGTCTCAGAAA
ATGTTTATGGGGCAGTCAGACTTTGTGGCAACAATGGCGAGGAGTCGCTTTGAGCATATTCGGGCGAGGTTTCAGGTGCACGCACCTGGAAGCGTGCCAG
TCGAGCGGCGCGAGCAGGATCCGTTGTGGCACAGCCGGCGACTGATGTCACAAATACAGGAGAAGTTCGCCGCGATTGCAGTCCCGGTTGGTGCTGTCAG
CTTAGATGAAAACACGGTGCGCACAAAGGCGCGATCGTCGGCTAGAACGTTCATGCCCTCGAAACCCGATAAGTATGGCGTGCGTTTCAACTCTGTTGTA
GGCTGGGAGAGCCTGTATGCCTACTCGGTGTGGGATAATGGATCCGGCAATCGCACACAGACCACCCCGGCTGACAGATACGTAGACGTCTTCCCAGCGC
TTAGATCAGCATTGTTTAGAACTCTAGATCGCGACGATGTCTGCATCAAACGTAAAGATGCTAGTGCTCTATGGATCGCGATGTGCGGCCACCTAACCAA
GACGTATCCAGCACCAACCCAGCACCGTTTGCTCGTTTGTGACAACTTCTACACTCGACACAATCTAGCTAAGACTCTGACAACGTTTACGGATGGCGAA
ATGAAGCTGCTGGGAACTGTTCGTATAGGATTACAGGGCAAGTGGATGGCCGAGCGTTTGGAGGCTTCGAAAGCAAGGATCGATAATGCTGAACGAGGCT
CGTGGGAGCTTATTGCAGCGCTGGATGTACCAGTCGACTGGGAGAAGCTTCAAGAGAAGCACAAGCGTGCGCAAAAAAAAATTCCAGCACACCGGCAGAC
GCCGTACATTCCGCCAACAACGACAGCTTCGAACGCGGGCTACATCGTTTTTCGCGACAAGAAAACCGTGGTCTTCTACACCAACGATCTGGCAGGTACT
CCTTCGCAGGATGTACTGCCTGGGCATTCTCAAGAGGCAATTCAGCTATGTCGTGGTCTTGCTCCGCTACGGCGGTGGACTGGAGACCAGGTCATGCACC
GAAAAACGTTCCAGGTACCGGCCATGATAGTAGCGTACAACCTCTTCATGAACGGCGTAGACCGAGTGGATCAATTGCGGAGCACCAATCCAATCCGACG
GAAGGAGAGGCGGCTCTCCATGAGCATCCTCACGTGGGCGTTGGACCTTGCGCTCATCAACTCGTTCGCACTGTTCCGAAAGGTAGCGAAAACTGCATCA
GCACGCATAACGCTGCGCGAATTCAAGCGGCGTGTAGCTCAGAAGTTGACATCCGTACAGCAAGCACGGTGGCAAAAAGAGCGCCGCAATCAAGCAGCCC
CGAACCAGCCCATTCAAGATGTTGTCGGAGCCGACGCGAGTCCCCATGCAATCACGCCCAACTCAAAGCAGCACTCCAAAGGCAAACTAACATGTTATCT
CTGCTCTCTGCGAGGATTTCCCAGCAGGAAAGCGCTTTTCGGGTGCACAGGGTGCCACAGAGGGTTCCACGTTGTTTGCTTTACAGCCTTTCACTTTCAA
GACGCACTTTCATCTAACTCAGCTGCCGTCCGGTCAGCCCTCGACGCTCTGTGTGCCGAAGCTTCAGGAGACCCCCTTGCACACACACGCCTGAAGAAGA
ACAAGACGATAACGTATCTAAATCAGCTTGAACTGCCATAACGTGGAGAAAAAAGCAATGTAGACGTACGTGACGATTGTGTTGAGGCGAGATATCTGCT
TGTCGACGCAGAGGGGTAGCTCGACGCGCGCCTCCCTGCACAGGCGCCCATTTTTCCTGTAAAAATATAGCTGTGCTAGCGCCTTCTTGACGCTCCGTGG
AGCTCGTTGTCCACGCCTCCGTGTCAACATTCGAAGCCTGCTGCTGATGATGTACTTGCTGTACTGGTCCCATTCACACGGCGCGTCGCCACAGTAGCTG
CATGCCCGCGTCGATTCCAGCCCAACCATCTCTGTGCCAGTTCCCCCCTTGCCAGTTCGGAATTTTGAATATGAAGCAGTACCGTGAGCGACTTCGCTCA
ACAATTTCACCAACCACGTGGAAAATCAAAGCCATACCATTCGCTGATTTTCGTTTTTACTGATAGCTTAGTGGTCGAGGTAGAGGTCCGGAGCGGACCT
ACAAAAAAACTCTGGTAGTGAAAGGGTTAATACGGAGTCGTTAGGATATAGCATATATTTCACTAAGCTTCAGTTACTTCAAATATTTGCTATGGCTGCG
CTGTAGGCAGTAGCCGGCCTGTATAGTCTGGATAACGATTGATTTTTAAGAATGAAATGTAGTGGTACAAAATTCTAATACATGGAATGCGATGCAAGCA
AACAGCATTTCAAGCATAGTACAGCGGTTGGTAGTACATCGTACGCCGCTGACCTATATACGGGTTATAGTACACGGGAGCTCCCCACAGCACATTTACC
CCAAAAGTCGATACTCGCTGGATAGGTTCGCCAGATACTTGACGGCTGGGGAGTTTCTGCTCCCACATACTGGGGTTCTTAAAGCCCATTGATGCCACTT
TCTTCCCCACGTCTGCCATGAACTGTTTCCTTTTTTGCTGATCGTTGTCGTCGACAGTCGCAGGTTTCACCTCGCCGACCGGTTCCGACTGAAGCTCTTC
GTCGACCTGCTGCTTTGGTACGATGGCGGTGTCTTTAACCACCTTGGACTCCTCTGTCTCATCGAAGAAGCCCTCGGG