Description :
From Genome Similarity Track
Location :
Scaffold_1662:5723- 6857
Transcript NameFunction/comments
Phypl_g13918hypothetical protein

Sequence
1134 bases(100 bases per row)
GAAGGCGCATGTGGAGACCAACCTTGTTATTGAGCAGTCCTCTCCGATATAGATCGTGGAGATGCTTCCGGACGGCTGTTGAGCCACGCGATTTAATGCC
TTGGACTTCAAAAAACGACATAACATCCGCTTCGGCCTGCTTCCCTAACTCGAGGACGTTGTCGCGGTAATCAACGGCGCCTGGATTGATCACGTAGCCC
TTGGCCAGGAAAAACTTCATGTAagcgacaagctgcttcgcgttggatcgctgctgctttggtGTATCTGCGTACTAGGGCGGTTCCTGGACATACCACG
CGCACCACGTGGTGTGAAGGTGAGTCACCGACGTCCGTTAGCGCTTGGCTTGTCTTGTTCTTGACTTGGTTCCTGCTGACGCTTTTTACTCTTGTTTTGT
GCTGGGGCTCCGTCCACTTTAGCTTCTAAGTTGTCTGAGCGCTCGTCTTGGCGCTTGGTGTGTGCCATTAATTGGTCAATGACGCTGCGTTGATAGTCGA
TGATCTTGCGCTCATTGTTTGGTTCCTTGTTCAGTGTGGTAGCTTGTTCTTGGCTTGGGCCAGTGCTTCCACAGGCGGCAAGATGTGAAGACAAtgcaag
aagctcagcgacaGACGCGCCACCATTCATAGCTTCCGACTCCAGGCGTCTGACTGCAAGCGCATCGGCGTCGAGCCTCTTCATCAGGGGGTAGTGCACG
ATGAGGTAAGCTGTGAGCATATCGGCTACTTGCTGACTCAGGTTGTACTTGGGGCTTTCCGTCGTGTAGCAGGTTCTGAACAGCGAGCATTGGACACCGG
TGatcttctcctgcgtctccgcgTCGAACTGCTTCAAGTCAAGCGCCTTGACTGCGGCATTCGTGCCGTACCCGCTGAGTGCTTTACTGACCATGTGATC
TTCTCTGCTTGTGTTGAAGATGTAGTTGAACCCTTTGCTTGTTGTCGACATGTTCCAGGCCCCACGGTCAAAGATCCAGCGGTATGTGAGGCCTTCGCAC
CCGTTCACGTGCTGTGCACCGCCGTGGCGAAACGAGTGCGACGTCAGCGGTGCTacgactccagcagcaggcgcgaTGCGGGTGAGCAGACGGTTGACGT
GGAAGTAAATCgttggagcagcagcgacaggctt