Description :
From Genome Similarity Track
Location :
Scaffold_7:572292- 574458
Sequence
2166 bases(100 bases per row)
CGATTCAGCGACGCCAATTCCGACTTGCGAGTTTCAGACAAGATGACACGACTGACCTTTGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGT
TGTATTCTCGTACAACGTGAAGATATTTAACTGATCGGAGCTTGGCCGCGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGC
GATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCCACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATA
CCTATATACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTATCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAAG
TTCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACAAATCCGCTGTAATTACGGGGAAGCCTGGCGTACAGCAACGCGGGGTC
CATTCGAATAGTCGGAGAACCCTTGTTTGGAGGTGCCACAGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCG
AAGGCGACATCTTTCTGCTTCACGCGCTGCACCTTCAAATGCCACTGCGAAAGCAGTACGGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTGT
GCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACATATCTTCAACAGCAGAAGTAACGCCAAAACTTC
CTTCTCGGCAGGATGGTAGTTCATCTCGGATTCCTTGAGCACACGACCGAGGAGCCGTACGGGGTGTAACTTGCCTTCATGCTCTTGCATTAGCGTAGTG
CTCAACGCCCATTCATTCGCGAAGAGCATGACATGAACTGCCTTCCACCGATCGAAGTGCCTGAGGATGGGTGAATGTGATACACTCGCCTTCAATTTCT
CGAAGAAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTAAGCTGGTACAGCGCCGCACCGTAGACCGCAAAGTCTTGTATGAA
GCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGTTCGGTGATGGCCGCAAGCTTCTTTGGATCAGCC
CTGATACCTTCTGGCGAAATTTCATGCGGCAGAAAGTCCACCTTGGGCTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACCTGTGCAAATCT
TGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATTCACAAACGACCGTCGACCAAACACAGGTACCAGC
GATGATTCGTCCGGTTCCCCGTTCGTAAAAATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCCACTGGTGCTTCGCGGTCTGCCG
CGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCTTAATTTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCA
TTTAGGTTGAGCGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATTGGCGCGTTCTTTAATCCAAAGGGCATGCGCAACCACTCGAAGTGT
CCGAGTGCGCAGACAAACGCCGACACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGTAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGC
ACTCGAGATCGGTTAACAGGTCGTCGACTAGCGGCATTGTATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTC
CAGCCCGTCCCTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCTCGCAACAAAGCGCGCAGCAACTCGTAC
AGTTTACCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAGTTGGGGCGTGCATCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGCGGCG
GCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGCTCTTCAACGTCGCGACCAGACGTTCTC