Description :
From Genome Similarity Track
Location :
contig_3:57227- 59973
Transcript NameFunction/comments
g820.t1hypothetical protein

Sequence
2746 bases(100 bases per row)
ACGTCGCAGTACACGTGGTGGAGCTTCGTGCCTGTGTTCCTGTACCTGACGTTCCAGAAGACGGCCAATCTGTACTTCCTGCTCATTGGCATTTTCCAGA
TCATCCCGTCCGTCTCGCCGACGGACGGCGTGCCGCTTCAGTTTATCCCTCTGGCTATTGTGATTATCATTGACGCCATCTTCGCTGGCTACGAAGACTA
CAAACGGTACATGGCCGACGACCTCGCCAACTCGGCCAAGACGCGCGTGTTTAACCGCCAACTGCGCGAGTTCGAGGAAGTCGAGTGGCGCGAGGTGAAG
GTGGGTGACTTTGTCAAAGTTGCCAACCACGAGATCTTGCCGGCGGATATCATGATTATGGCGGTAATTCCTGCGGAAGGAGCACGCTCTGGTGGAAACA
TGGGGCTCTGCTACGTCGAGACGAAGAACCTCGACGGCGAAACCAACCTGAAGCTGCGGGAAGCACCTCAGCCCACCCGCAATGTTTTCATGAACGAGGA
TGAAGCCGGGTTCATTGTTCAAGGTTACGTCGAGAGTGAACTCCCGAACGGAGATATCAACCAGTACTCGGGTACGATGTACTTGGAGGAGAACCCGAAT
GGAGGGAGCGCTGAGGGAGTCCCTCTTTCGCTGAAGAACATGCTGCTCCGCGGCAGTAAGCTGCGAAACACCAGTTACGTGTATGGCTTGGTGGTGAACA
CGGGTGTGGACACCAAGATTATGATGAGCTCTGGCGATGAGTTCCCCGTGAAGGTCTCGTCTATTGACGAGATGACCAACAAACAAGTGATCGTCGTTGT
TGTGATTTTGATTCTGATGTCGCTCGTCGGTGCCATCGGAGACAGGTTGTGGATGGATGGTCTCAACGTGCCGGAGTATTTGCATTTGGACGGCTGGGAT
GACAGCTTTATCGAGACGTTTGTATACTTCTTCACGACGCTCGCCTCAATGGTGCCTATCACGCTCTACGTGTCTATCACTCTCGTGAAGGCCTTGCAAG
GGTATTTCATGGAGCGCGATCTTGACATGTACGACGAAGAAAGTGGCACGCCGGTGAAGGTTCGCAACATGCAGCTGAACGAGCAGCTAGGTCAGATCTC
TCACATTTTCTCGGACAAGACGGGCACGCTTACTTGCAACAAAATGGAGTTCCGTAAGTGCAGTATTGGCGGCCGAAGCTACGGCAAGGGTACTACGGCC
ATTGGCATTGCTGCGCGCATGCGTAGTGATTTTAAGGGCCAACCTATCGATGAAGAATCGGCAAATGAGAACGACGCAGATGCACGCGTCGAGGTCCCGG
TCCCCAACGTCAATTTTAAGGACAAGACAATGTGGCGGGACATAGAAAACAAGGACGACCCTCAAAATGAAAAGATTGAGGAGTTTCTCACTCTGCTGGC
GTTGTGCCACGGTGTCCTGATCGAGCGCCTGGACCCAACGGAAGAGGATACCAGTCCGCCTATTCACTACTCAGCTTCATCCCCAGATGAGCTCGCACTT
GTTTGTGGTGCTAAGTTCTTTGGTTACGAGTTTATCGAGCGCGAACCGGGAAGTGTTTCTATCAAGAAACCCGATGGCGTCGTGGATCAGTATGATATCC
TAGAGGTTTTCGAGTTCGACTCCAACCGCAAGCGTATGTCAGTTATAGTTCAGCGACGAAAGCGTGACGATGAGCTGCGTCAGATGTCTGAAAGCGAGGA
AGATGACGTTCTGCTTCTCACAAAGGGAGCTGACAGCATGCTGTTTCCTCGACTCGCCCCGATGTCGGCTAACAACCAACGAATCCGCGAGTCTACCGAG
AAGCACCTAGAAACGTTTGCTCAAGATGGGTTGCGTACGCTGGTCGTGTGTGCAAAGCGAATCGATCCCCGCGCGTGGGAGGACTTTAACGCACGGTATC
GTCATGTTTCTGCAGACCTCAGCGAAGTGGAGGCCAAGTCTCGTGGAGAGCCCAATGCTCTTGACAGACTTCAGGACGAGATGGAGTCAAACCTGGAGCT
GCTTGGTGCGACTGCAATTGAAGATCGACTGCAGGATGGCGTGCCTGAAACGATGGAGAGTCTTGCTAAGGCTGGGATCTGTATTTGGGTATTGACTGGA
GACATGGAGGAGACAGCGATCAACATCGGCTACGCTTGTCGCTTGCTGAACAATGACATGGAACGACACGTGATCAATGCGGCAAAGTATCGCACGAAGG
GCTCGATCCTACGAAGGCTCGACAAGATTTTCCACTCCATTCACGATGCCACTGATGACGCTTCTCGCACGTCAACTGTTGCCGCCCACTCCGTCTTGTC
GCCACCGTCGGGTGAAATTGAGCACGCGCTGGTTATCGATGGTGCATCACTGAATATGATTCTGGAAGACCCGCTGCACAACTTGCATCTCCTGCGTGTA
GCACTGCTATGCAAGGTCGTGGTTGCATGCCGTGTGTCGCCTCAGCAGAAGGCACAGCTGGTGGAGCTAGTAAAGTTGAACGTTCCGGAGTCTCACACTC
TTTCCATCGGTGATGGCGCCAACGACGTTCCAATGATCCAGAGCGCTCACATTGGTGTTGGCATTAGTGGACAGGAGGGTTTGCAAGCTGTGAACAGCTC
GGATTACGCGCTGGGTCAATTCCGGTTCCTGAGTAACTTGATTTTGGTTCACGGTCGATGGAACTACAACCGAGTTGCTGCGCTTGTCGTCTACACGTTT
TACAAGAACATTGCGTACAATGTGTCCATGTTTTGGTACACGCTGT