Description :
From Genome Similarity Track
Location :
contig_3:57223- 59969
Transcript NameFunction/comments
g889.t1hypothetical protein

Sequence
2746 bases(100 bases per row)
ACGTCGCAGTACACGTGGTGGAGCTTCGTGCCTGTGTTCCTGTACCTGACGTTCCAGAAGACGGCCAATCTGTACTTCCTGCTCATTGGCATTTTCCAGA
TCATCCCGTCCGTCTCGCCGACGGACGGCGTGCCGCTTCAGTTTATCCCTCTGGCTATTGTGATTATCATTGACGCCATCTTCGCTGGCTACGAAGACTA
CAAACGGTACATGGCCGACGACCTCGCCAACTCGGCCAAGACGCGCGTGTTTAACCGCCAACTGCGCGAGTTCGAGGAAGTCGAGTGGCGCGAGGTGAAG
GTGGGTGACTTTGTCAAAGTTGCCAACCACGAGATCTTGCCGGCGGATATCATGATTATGGCGGTAATTCCTGCGGAAGGAGCACGCTCTGGTGGAAACA
TGGGGCTCTGCTACGTCGAGACGAAGAACCTCGACGGCGAAACCAACCTGAAGCTGCGGGAAGCACCTCAGCCCACCCGCAATGTTTTCATGAACGAGGA
TGAAGCCGGGTTCATTGTTCAAGGTTACGTCGAGAGTGAACTCCCGAACGGAGATATCAACCAGTACTCGGGTACGATGTACTTGGAGGAGAACCCGAAT
GGAGGGAGCGCTGAGGGAGTCCCTCTTTCGCTGAAGAACATGCTGCTCCGCGGCAGTAAGCTGCGAAACACCAGTTACGTGTATGGCTTGGTGGTGAACA
CGGGTGTGGACACCAAGATTATGATGAGCTCTGGCGATGAGTTCCCCGTGAAGGTCTCGTCTATTGACGAGATGACCAACAAACAAGTGATCGTCGTTGT
TGTGATTTTGATTCTGATGTCGCTCGTCGGTGCCATCGGAGACAGGTTGTGGATGGATGGTCTCAACGTGCCGGAGTATTTGCATTTGGACGGCTGGGAT
GACAGCTTTATCGAGACGTTTGTATACTTCTTCACGACGCTCGCCTCAATGGTGCCTATCACGCTCTACGTGTCTATCACTCTCGTGAAGGCCTTGCAAG
GGTATTTCATGGAGCGCGATCTTGACATGTACGACGAGGAAAGTGGCACGCCGGTGAAGGTTCGCAACATGCAGCTGAACGAGCAGCTAGGTCAGATCTC
TCACATTTTCTCGGACAAGACGGGCACGCTTACTTGCAACAAAATGGAGTTCCGTAAGTGCAGTATTGGCGGCCGAAGCTACGGCAAGGGTACTACGGCC
ATTGGCATAGCTGCGCGCATGCGTAGTGATTTTAAGGGCCAACCTATCGATGAAGAATCGGCAAATGAGAACGACGCAGATGCACGCGTCGAGGTCCCGG
TCCCCAACGTCAATTTTAAGGACAAGACAATGTGGCGGGACATAGAAAACAAGGACGACCCTCAAAATGAAAAGATTGAGGAGTTTCTCACTCTGCTGGC
GTTGTGCCACGGTGTCCTGATCGAGCGCCTGGACCCAACGGAAGAGGATACCAGTCCGCCTATTCACTACTCAGCTTCATCCCCAGATGAGCTCGCACTT
GTTTGTGGTGCTAAGTTCTTTGGTTACGAGTTTATCGAGCGCGAACCGGGAAGTGTTTCTATCAAGAAACCCGATGGCGTCGTGGATCAGTATGATATCC
TAGAGGTTTTCGAGTTCGACTCCAACCGCAAGCGTATGTCAGTTATAGTTCAGCGACGAAAGCGTGACGATGAGCTGCGTCAGATGTCTGAAAGCGAGGA
AGATGACGTTCTGCTTCTCACAAAGGGAGCTGACAGCATGCTGTTTCCTCGACTCGCCCCGATGTCGGCTAACAACCAACGAATCCGCGAGTCTACCGAG
AAGCACCTAGAAACGTTTGCTCAAGATGGGTTGCGTACGCTGGTCGTGTGTGCAAAGCGAATCGATCCCCGCGCGTGGGAGGACTTTAACGCACGGTATC
GTCATGTTTCTGCAGACCTCAGCGAAGTGGAGGCCAAGTCTCGTGGAGAGCCCAATGCTCTTGACAGACTTCAGGACGAGATGGAGTCAAACCTGGAGCT
GCTTGGTGCGACTGCAATTGAAGATCGACTGCAGGATGGCGTGCCTGAAACGATGGAGAGCCTTGCTAAGGCTGGGATCTGTATTTGGGTATTGACTGGA
GACATGGAGGAGACAGCGATCAACATCGGCTACGCTTGTCGCTTGCTGAACAATGACATGGAACGACACGTGATCAATGCGGCAAAGTATCGCACGAAGG
GCTCGATCCTACGAAGGCTCGACAAGATTTTCCACTCCATTCACGATGCCACTGATGACGCTTCTCGCACGTCAACTGTTGCCGCCCACTCCGTCTTGTC
GCCACCGTCGGGTGAAATTGAGCACGCGCTGGTTATCGATGGTGCATCACTGAATATGATTCTGGAAGACCCGCTGCACAACTTGCATCTCCTGCGTGTA
GCACTGCTATGCAAGGTCGTGGTTGCATGCCGTGTGTCGCCTCAGCAGAAGGCACAGCTGGTGGAGCTAGTAAAGTTGAACGTTCCGGAGTCTCACACTC
TTTCCATCGGTGATGGCGCCAACGACGTTCCAATGATCCAGAGCGCTCACATTGGTGTTGGCATTAGTGGACAGGAGGGTTTGCAAGCTGTGAACAGCTC
GGATTACGCGCTGGGTCAATTCCGGTTCCTGAGTAACTTGATTTTGGTTCACGGTCGATGGAACTACAACCGAGTTGCTGCGCTTGTCGTCTACACGTTT
TACAAGAACATTGCGTACAATGTGTCCATGTTTTGGTACACGCTGT