Description :
From Genome Similarity Track
Location :
Scaffold_24:572220- 579329
Sequence
7109 bases(100 bases per row)
CCACCTATAAATATACTCAGCTTACAGCCTACCTTAAATTGTGTTTTTTGGTCACCTTGCTCCCTTTAAGTAAAAAGGGACCTGTGAGCTGCCGTTCACT
GAGAGTTTGTAAACTCTCGGAAGCCAACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTTACCCTTGATAGCACTCGTAATCAATCCACGCCAAAGCTG
GTAGACTACCTGAACCTCTCTAAGATTTGTTGCCTTGGATATGAACAACATTATCCATCCGAACGGCTCACAGTTCGAGTTGGTTCAGAAGATGGCAGGT
ATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTAGTGTCAACACCGGCCGCGCAGCTCGTGCGCGTCAATGCGTTTGACGCTTACGAGCATGGGCTCATCG
CGCATGTGCGTGAGAACCTGCAGGCTCCGGCGGTGGAAGCGAATCCACCTCACCCGAAGCCAATTCGGCTGAAGGTTAAACTGTTTGAAGGGAAGGAAGG
CGTGAGCCTTCACTTCTGGGTCCGAGAAGTATAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTT
AGCGGCCGTGCTAAGCGTTGCGTGTACACACGGGAGGCAACATCCCCTGGATGCTTCACATCCTGGGCTCAGCTGTGTGAACAGCTTCGAGCCGCGTTCC
TCCCGGCGAACTACGCGTACCGCCAACGCTGCGCTTCCTCTCGTGCAAGCAAGGAGGCGTGATCTGCACGAGTACGTGCAAGAGATACGGGAACTCATGG
CGTCCCTAGTGGGAAACCCAGTCAACAAACACATCAAGATGACTGTGTTCATGGACGGCCTTTGAGTGGGACCCGCACGTACTCAGCTGCCCGGGTGCAG
TCAAACACCCTTGAAGAGGCGATTTAAGTGACTCTTCAGGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCGGCGTGGCCTGCGGGCTACTTGT
TGACTCCCGGTCGAACGAGCCCCAACGGACCAGTTCCCATTGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCC
ACTTCAAGTGCGACTGTCCCGCGGAAAGGCTCTGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCTCGGGGACAGGG
GAACGCCGGAAACCAGTAGTGGCGGGGCGCCCTACTAGGGAAGGGCTAAGTCGTCTTGATGGGTGCGCGGGCGGCGCGTACCACGACTACTTAGTCCCTG
AGAGTATTCGCACCCTCGAATCGGTGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGAGGATACGATCATCCCTTTACAATCTTGATCGA
TTCTGGGGCATCGAAGAATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTGTCCAATGTTTTGAGTGAAAGCAAGGGCAACGGGACGGTG
TCAGTACGACTGGCCGACGAGAAGGTCGTCACTGTTCCCAGCGTCCAAGTGGATCTGGCCGTCAAATTTGAAGAATTTGACAGCCTCGAACAGCTCACTG
TTCTCGACATGGATCCATACGATATGATCCTGGGCATGGCCTGGCTTGAGGAGCACGCACCCTAGATCGACTGGCGAAGCAAGGCAATCGGTGCCAGCCG
CCCTGCGCAGCCCGACGGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCGGGGGACCAAAGCGTCCGGCAGA
CGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAGGAGGCGCTGGCCAAGTGAGTAGCTTAGGTCCACAAG
CGGGTAACTTAGTTCCGCAGACAGCTGTAGCTGTCACGAACTTTGACGATAGCGTGTTCCTTGTGGGTAACAGAGTTCCACACACGGTCGCCCGGACCTT
AACGGAAGAGGAAGACATCTTCCCGTGTGGGTAACATAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGTGTTGAGCACGCTTCCTGTGT
GGGTACCACAGTATCACACGAGGCCACGAGTGCCTCGGATGTCGGAGCGCCGACATCCCCAGACGTGGGTAGCAAAACTTCACGTCACGGTCGCCGTCGA
CGACGACGTCGCTTCAAGCGACTCGGAGTCCAGTGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCGCATCTTCGATGGCGAGACCGGCTTA
CTCGTCAAGGCATCTGGTGTCCACTTGGAGCCGTTGCCAGAGGCTGCAGAGATACTGAACCTCGAGGAAATGACGGTCAAGCCTTTCCTGGTCAACCTCA
AGGCTGGAAAGGTTACCGAAATGGTGCTCATGAGACCTGAGACCACTCGGCAGGAGCTGAACTCCTCCTCTGTTTTGGACGAGAACGTCCTGGAAGACCT
GAACAAGCAGCATCAGACGCGCTTGAATTCTGAGATCCTAAAGAATCCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCAGACGTGGTGAACAA
ACACCCACGGACCCAGCTTCAACCAGATCGAGGCGTACGGCATTAGATTGATCTCGTGCCAGGCACAAAGTATTGTGTCACGAGGTAATGGCCTCTTCCG
CGCGAGCTGTGCGAGGTCATTGTTGCCTTCTTCGCTGCGATAGCGAAGGCATGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCAACCTTCTGCG
TTCGGAGCCCGAACGGAAAGTGCCGTCTAGCTCATGCTTAAAATAAACTGAACAACGCGATGGTGCCGGCTTAAACACCAATCCCACGAAAGGACGTGTT
GTTAGACAACTTGGCAGGAAGCGTACAGTAAAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCTTGATGCGCGAGAGCGACATCCCACTCACTGCG
GTGGGCACTCCATGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAGCACCCCGGCGACATTCAGTAGCCTCGTGACGCAATTGTTCA
GGCCACTGCGCGCCTTTGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGACGCAAGACGGCCATGGAGGTGCATCTGGGCACATC
CGTCGAGTGTTGGACGTGATGCGACCGAGCAGGCTCGACGTCAACATCGACAAGTGCCTCTTCGCGTCATCAGAGATTAAGGCTCTCGGTTGCTTCGTAA
GCAACGTGGGCGTTCGGGCTGACCCAGATAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATTCCAGAAGGATCTTCGAAAAAGGTTGGGCTTGGC
CAACTACCTTCCCAAGTACAGAGCAGGGTATGCGGGCTTGACTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCACTGGGAGCAAGAGCAT
CGAAATGCCTTTGACAGCATCAAGGCCAGTCACCAAAATGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCGTCCG
ATTACGCCATCGGATGTGTATTGCTGCAGGTCGACACGGCTGGACATGAGCGAGTCATCTCGTTACAGTCCAGGCGAGCTCCTGGCAATGACATATGCCC
TTGTGAAGTTTCGTGTTCACCTTCTAGGCTCCCGGCTCTTCGTGTTCTACACAGACCACGCATTTTTGAGGACGGCGACAAATTCGCCTCACCTCTCCCA
AAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAACTCAACGTGATTGCGGACGCCCTCTATCGGCGT
CCTGACTACAAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGAGCGGATATGCATGGCGTATCGAGACGATGAGGCTGTCGCGCCTATCGTCA
AGTTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAGAGATGGCCTCCTCTATTA
CAGGGTGGAACCCTATGACCCTCCACGGGTGGTCGTACCCAACGACTAGGATCTGAAGTTCGACATCCTCGCGGAAGCGCACGATACGCCATCCAGCGGC
CACTTGGGTCGCGAGAAGACCGACAGCACCGGAATTTTGGTGTTCGTGTGTCAGCTGAGCAAGATGTACCATCTTGCTCCAGTTCCCGTTACCGCTACGG
GCGAACAAACCGCAAGGTTGTTTGTCGATAGCGTGTTCCGCTATCCCAGTCTCCCGGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACGGCTGCGTT
TTGGAAAACGCTGTTTCCTTTCCTGGGAACTCGTCTGCAGATGTCCACTGCGGACCACCCGCAGACAGACGGCCAGACAGAGCGCATCAATCGAGTGCTC
GAGGACACTCTGCGCAGTGTGTGCGCGACAGCCCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACTACGCGGTGCACGCGTCCA
CGGGGTTCACGCCGCTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCCTCGAGACACTAACCCCTCTATTCTAAGTGGGGGAGAGGCTCT
GAAAGCTCTTTCCTCCCAGGTCTCAGCTGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCGTTTTGGATACCAAGCTGAGCATTGTCAGCAGGGTC
CGCGATGCAATGGCGGCGGCCCAGGATAGACAAAAGGAGTACTCCGGCAAACATGGAAGAGGAAATTTAAGTGTATTTATAGTGGGGGACTTAGTGATAC
TAGCCACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGG
TACGTCGTACACCATCGCCCTCCCTAAGTCAATGACGGCGCACCCGACGTTCTATTTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGAC
TCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCGAGGGCCGGCCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCTGAGCGGCAAG
GTTGCGGTCAAGACTGTACGCAGGAGGGTCTCCATACGAACGGGCCCCGGAGACATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTTC
GTCTGGTAGTGCGTCGAAGGCGGCTCCGGACGTGACAACAGACGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATC
CACCCGCAGATGCAGGATCGCGAACTAACGCCCCAACAGGACCAGGCGGGCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGTCTGGGCGGCAGTATCA
CCGCCAGTCCCAAGGCCAAGTGCGATCTCAAGCACGAGAACACGTTGACGGAGGCGGTCAACCTCAAGGCACCCGCAGGAGAAGGACTCGGACGAGAGTG
GCGTTCGGGAGGCCCCAAGGACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAGTGAAGAAGCCACTTCCACGTGGAACGGATCCTCCAG
GAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGCCATGCCACTACGAGAACTCGTCAATCAGCTCCTGATTGACTGCCCGAAGGCT
GTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTTCCGAACGGTGTACGGACGTTGAAGACACTCCGTACCCGCGCTTA
TCATGAGCGCTAGAAGCCGCGCGCTTCAAGATGTCCCTTGGCAGCATGCGCTTGCTGACCATGTGGGCAAACCGAACACGAAGATCACGCTGGTCCAGGA
TGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCTCGCGAGATCGCCA
GGTGGGGCAGTTCTCGGGCAGAACCCAGATGTACCCCCAAAAAGGATAGAGACCACCCCGGCTCTCGGGCTTCTTACGACACGTAGTGAAGGCCTTAAGA
GGGATGCAGTGTGGCGCGAGAAGCACACACCGAGCCGCCTCCAAGTTGTCAACAAACAACTGTTCCTTCTAGGCAAGAGCACGTTCGTAAATGCCCCTAT
AGGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCCAGGAAGAGGTCAGCCCAGAGCTCTCCTTGGGAGGCCAATACCCTCTTGCGTTGATG
GCAGCTCCCTGGCTGACGGGTGCCACCGCCGAACTTCCACGCGAACGCTGGGCAGCTTGGAAGTCCTCCTGCTTCTAGTCGAGGTCATTAGTGATCTCTC
GGGGCTCCGAAATAGCACCCTCCTCCTCATCCTATTTCTTCTCCTTCTCGTCCTCTTCACCCGAGGAGTCGAAGAGGCCCCGATGAGGGTACCGAGTCTC
CTTCTCTGCGGAGTGGAGACTTCGAAGCCAAACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCACGAGCAAGTTTCTCGGCAAGCGA
GAGACGGTTGCCAGGCTTACCCTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGACCGGACTCTCAAGTGCACATACGTCCTGGGACTGT
GATCACCTTGATCACTAGCGAGCGACTACACGCTGTCGTCTTTGTGTTCGCTGGGCACTGGGCTGTGCCCTCCCGCAGAGTCCGCAGGAGCATCGTGCGT
GCTCTCGGACACGGCTTCGTCCTCACTGCCAGAGTCGAACTGACGTTCAGCGAACCGAGGGTTCGGACGGTTGTCTGGGGAGGCCGAGGGCGACGGACTG
CGGCGCTTGCTCGTTCTCTTGGCCACAGCCGCGTCACCCGTTGAGCCGATCTCTTCGGAGACCACTTTAGTAGCCTCCTGGAGTGCCGAGCCTTTGCCGT
GAGAATTAG