Description :
From Genome Similarity Track
Location :
scaffold_189:5721- 12362
Transcript NameFunction/comments
g5354.t1 callose synthase, putative

Sequence
6641 bases(100 bases per row)
CGCCGGCGTGCCAGCTCCAACTACTTCGAGTTGGATGCCGATCGCCGCCGCAACAAGTCGGAGCGCTCTGAGCGCTTCAGCCAGCGCTTGAACACGATGG
ACGTGACGCCCGCGAGCTTCAAAGGCGCGTCCACGGACGACGAAGCGGCCATTGATTACTGCTGCGAATTCCTCAAGGCTAAATTCGGATTCCAGGAAGG
ATCGGTGAGCAACCAGCGCGAGCACGTGCTACTTCTTTTGGCGAACGGCAAGGCGCGTTGTTTGCCAAGTGACGCAGCTGACGAGCACCTGGTGCAACTT
GCCAACAAGCTTTTCACCAACTACCGCTCGTGGTGCAAATTTATCCACACGAACCCCGTGACGTACACTGGAAGTGGCATTCCGCACTCTACGCCTTCTG
GCAATATGCACATGGACGTCATGTTGTATTTCCTTATTTGGGGAGAAGCGGCCAACGTCCGGCACATGCCAGAATGTGTATGCTACCTTTTCCACCAGAT
GCTGACAATGGTGAACGCCGACCCGCAAGGCCACGAGCGGCAACCCGAGGGCTGGTACTTGGAGCAAGTGGTCCGTCCCATTTGGAGAGAAGCCAGCAAC
ATGAAGCGTCGTAACGCGCTTGGCAAACCTTTGGAACACGTGAAAATCCGAAATTACGACGACATCAACGAGTACTTTTGGAAACAGCACTGTCTCAGCA
TCCCCGTGGCTCAAGTGGGCCAGGAACTGACGCAAAACCACGGCAAGACTTTCTACGAACACCGAAGTATTTTCACCTTGGTGCTCAACTACTACCGTAT
TTTCCAGTTCAACATCATGTTCCTGGTGCTGCTTTCGGTCTTGGCTTTTGCCGTTACCATTTCGCCAGACGGTGGCAAAAGTGGTTGGGTGCAATTCGGC
CGTATCGGTGACGTGGTGGAACCTTACACCACTCGGGACTTGAAAATTACCGTTGTTGCCATCCCATTCAGTCTGAGTCTGATGGCGTTTTGCAAGTGTG
TCATGGAAGTTTGCCACGGATGGCACTTGTTGACATCCAAGGAGAGTTCGGCCACTAGTTCGCGCTCGTTCACGTACGGAACGGCTCTTGCCACTCGTAT
CATCTGGAACGGAGGCTTTGCCGTGTTGTTCGGGATCATGATCTACGTGCCTATGAACGAAGACAAGGATACGACACTGCTCGACAATTTGTACCCGCTC
TGCGGTGCCTACATCCTGCCTGGTCTGTTAGTGCTGCTCACACAGGCGTTCGCGCCTCAAGTCATCAACGGAACGTTTGCAGCCAAGTTTGTCCGTGAAG
GTGAAAGCTGCTACGTTGGACAGGATATGACGCCTCCGTTCTCGTACCAGGTCAAGTACATTTTGTTCTGGATTCTGCTGTGGATCGTCGAGGCCATCAC
GTCGTACTTCATTCTGGTTCGTCCGCTGATGCTACCGACGTTGAGCATTTACGCCATGACGCTGGACTACCAGAACTCTCTGGTGTCGTTCCACAACGTT
GGCATTATCATCGCTTTGTGGCTGCCCGTGGTGTTCATTTTCAACTACGCCACGCAGATTTACTTTACGATCTTCCAGGCTCTGCTCGGTGGATTCCAGG
GTATTCTCATGAAGACGGGCGAGATCCGAGGGGCCAAGGAAATGACCAAGGCTTTCCGTGTCGCTCCTCAGTTGTTCGACCAGAAGGTTGTGACGCTTCT
CGCTCGCTCAAGCGATGCCACTGCCAGTGGGACTGACTCCACCCGTGCCAGCGCTTTAGCTGCTGCGTACGAATCGCAGATGATGCTGCGCTTCGTTGTG
GTGTGGAATGAAATCGTGAACTCATTCCGTGAGGGCGATTTGCTGGATGACAAGGAGGCGGCTATTCTTCAGTACGACATCCGCAGCACCGGTGAGGTGT
TCGAACCTGTGTTCCTGTCGGCTGGTAAGCTGACGGAGGCTATGGGCCTGGCTATCAAGACGGCTAAGGACGGCAAGGGCGAGTCCCAGCTGCGTGTGAC
GCTTGTGGAGAACGACTGTCTCTCGGCTATCCGCTCGTTCTTCACTGCCAGCATGTATGTTGTCAGTGCTCTGTTCGGCAACGACGACGCTGATGTGGTC
GACGGTTTCCGTATGCTCGAGGAGATCGCTTCTAGCGGCGGCTTCCTCAAGTCGTTCAACGTGCGTGAACTGGCCAGTCTTCGTGTTGCTGCCGTTGACC
TTCTGGAAGAGATTCTGGACCTGCCTGACCCGGACGTGCAGTCGCAACACATCCCAAACGCTCGTGTGCACTCGATGGGTGTGATTCGCAACTTCGTCTC
CAAGATGGAGGCTTTTCTGAATGGTGTACAATCGTTCTGCGTGGACCCTGCTCTTCAGCGGAAGTTTGGCAGCTCCAAGTTCTGCTCTAGCGCGAACGGA
TACATGTTCGCTTCGCGTGGCCTTGTGAACCTGTTTTGCAGTGATACGGCTATGGGTGCTGCTACGCGTGCCTGTCTGCTGTTGTCTCTGGATCGGTCGG
AGGCGATGCCCCGTACGACGGAGGCCCAGCGTCGTCTCGGTTTCTTCATGAAGTCGCTAGTCATGGACATCCCTCAGCTGCGCTCCATCAAGGAGATGCG
CAGCTTCTCCGTTGTGACTCCGTTCTACGCTGAAACGGTCTTGTTCTCGCTTAAGGACTTGAACGACCCGCTTGTGAACCACCCGATCTTCCAACAGGTG
GAGGAAGATGGCAAGAACCTGACGATCCTCAAGTACTTGACGAAGATCCACCAGGAAGAATGGGACAACTTCTTGGAGCGTGTGGATGTGAGTTCCGCCG
AGGAGGCTCAGAAGAACCACCCCGAGGAGATCCGTCTGTGGGCATCGTACCGTGGCCAGACTCTGGCTCGTACCGTACAGGGCATGATGATGTACGAGGA
TGCGATCAAGATCTTGCACTGGTTGGAAATTGGCTCAAGTCCTGGCAAGTCCGGAGAGCAGAAGCAGAACCAGCTGCAGGATATGGTCCGTCTGAAATTC
TCGTACATTTGCGCTTGTCAGGTGTACGGAAAACACCGCCTTGAAGGTAAAGCCCAAGCCGCTGACATTGACTACCTGCTGCGCGAGTACCCGAACCTGC
GTGTAGCTTATGTGGACACGGTGGAGCACGAAGGTGGAGAGAAGTCGTTCGACACTGTGCTGATCAAGAGCGAATCCGACGAAATTGTGGAAGTGTACCG
TTACTCCCTCCCTGGCGACCCGATTCTGGGTGAAGGAAAGCCCGAGAACCAGAACAACGCCATCCCGTTCACACGTGGCGAGTTCGTCCAGACGATCGAT
ATGAACCAGCAGCACTACTTCGAGGAGTGTCTGAAGATGCCGCAGCTCCTGTGCACGGCCGACCTGCACCCGTCTAAGAAGCCTGTGTCTATTATTGGCA
TGCGCGAGCACATTTTCACGGGTAACGCCAGTTCTCTGGCTAAGTTCAAGACGTGGCAGGAGCTGGTGTTCGTCACGCTGTCCCAACGTGTCCTTGCTGA
CCCTCTGTACGTGCGTATGCACTACGGCCACCCCGATGTGTTCGACAAGGTGCTGGCTATTACGCGTGGTGGTGTGTCCAAGGCTTCCAAGGGTATTAAC
CTGTCTGAGGATGTTTTCGCCGGTTTCAACTGTACCCTGCGCGGTGGAGTGGTGACCCACGTGGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTC
TATCGCAGATCTCGATGTTCGAAGGTAAATTGGCTAACGGTGCTGGTGAAACTTCATTGGCGCGTGAAGCTCACCGTATGGGTCAGTTCATGGACTTCTT
CCGTCTGAACTCGATGTACTACTCGCACACTGGTTTCTACTACGCGACGTGGATGACGATCGTCACGACGTTCGTGTACATGTACTGCAAGGTCTACATC
GCTCTGTCGGGCGTGCAGACGCAGATTGTGTACAACATGAACACGACGGAGATCATCATGGACAACTCGTTCGACTACGGCTTCGATGACCGCGTGTACT
CCGACATGGACTCGGTGTACAACACGCAGTACTACATCCAGGCTGGTCTGTTCCTGTCGCTGCCGCTGATCTGTGTGTACTTCGCTGAAATGGGTCTGCG
ACGCGGTCTCGTGCAGTTCTTGGAGATGGTGTGCACTCTAGGCCCGGCCTTTTTCATTTTCCAGCTTGGAACGACTATGCACTTCTTCGACAACAACTTG
CTGCACGGCGAGGCGCAGTACAAGGCTACGGGACGTGGATTTAAGATCACGCGTGAGACGTTCGTGCTGCTGTACAAGGCGTACGCCAACAGTCACTACC
GTAAGGCTATGGAGCTCGTTGGATTGTGTCTGGTGTACTTAACATTCGGCAAGTTCGACATTTGTGACACCTCAGTGGCTGGTGAAACGAACTCGTTTGC
CTTTGAATACTGTAAGACGTCGCAGAGCTTCGGTGTGCAGACATTTGCTATCTGGGTGATCGCAGTGGTGTGGCTGGTGTCTCCGTACATCTTCAACACG
GACGGACTCGACTGGGAGAAGACCAAGGCCGATGTGACGGCCTGGGCCAAGTGGATGTACGCTGCAGAGGACTACAAGGACGAAGACGCGGTGATGGTTG
GCGGATGGATTGGCTGGTGGAAGGGCGAGCTCAAGCTGTACCATAACACGAAGCCTATTGCTCGCTTCACGGTCATTCTGCGCGAATGCCGCCACTTCCT
GCTCATGTGGTACGTGGTGGCTCTCGAGTGGGAAATCCTGACGGTCGGCCTGGTGTTTGGCGCCTCCGTGGTCACAGTTCTGGCCATGGGTCTCTTCGGA
GCTGTCGGCGCTACTATGCGCAACATGAAGGCGTCGACCCGCGCGATCCTGTACACGTTTGTGGTGGTGGTGGCGCTCATCGCGTTCTTCGTGGTCACGC
TCGTCATCTCTGACTTGAGCTTTACTCGTGCGATCTCTCTGTTCTTCGGCTACATGGCTGCTCTGTACGGAATCAACGAGATGGCGCGCATGTACAGCTT
CGCGAACTCGGGGATCGCTACCGTGGGCATGTTCCAGCAGTTGGCGTTCTTCTTCGACTTTGTGTTTGCGGTGGCTATGATCGCCCCGCTTCTCGTCATG
TCGGCGATCCCGTTCCTGAACATTATCCAGACGCGTATGATGTACAACAAGGGCTTCTCGGAAGTCGTTTCGGCTTCGTCGCAGTACGCCTTCTCGCTGG
CCGCCTTCATGGGTGTGCTGGGTGGCATGGGCTGCGGCTGGCTGTTCCACTTGTTCACTACTCTTGAGAGCACGGCTGGTTTCCTGAGTTACGTCACGAC
GTACGACCTGTTGGACGGCAACGTCGGGGACGGCTCTGTGACGTACGCGTTCTACTTCGCCAGCATGGTGGGCACGTTCGTGGCCGGTTTCCTGAACTAC
TTCATCGGCCGTCGACTGTCGATCGTCTTTGGCGGGTTATTGACTGTTCTGGGTATGCTGGGCGTGAGTGCGGTGCAGACCGGTGGTGAAGGCTTCCTGA
TGCCTGGTATTTGCTTGCTTGGTGGCTCTGTGGGTGTGCTGCTGCCGACTTTGGCTGTGTACATCTACGAAATTTCGACCCGTGATATGCGCGGCAAGGC
GCTGTTGCTTCTTGGCAGTGGCTTCATCTTGGGCATCTTGTTCGCTGCCTGGTTCTCCTCGTCGTCGAACGAGGTCGGCTGGGTGTGGCAGGTGTTCATT
GCGACCATCATCCTGTCGATCATGACCCCGGCGGTCTACATCTTCCCGGAGAGTCCGTACTGGGTGTACATGCGCGAAGGTTTGGAGTCGTGCGAGCGTT
GTCTGGCGGTTCTGCGGCGTAAGGAGGGAGTGTCGGAGGAGCTGCGTATGATCCGCGACGAAGAGGCTGGAAGCGACGACTCGAGCGCCAACGGCGGCAC
GTCGTTCCTCAAGTTCATGATGGGACTGTTCCTGATGCTCGTCTCCAGTATCTTCCTGGGCTGCGTCAACATGTACCTGTCGGACACGTTCCGCAGCATC
GAGGACGCGACGTACATGTTCGTGAACTGCATGGGCTTGCAGTTCCTGGGCGCTCTCTTCTCGTTCTTCTTCATGGACCGCATCGACCACAAGCGCATCC
TGTTCTGCACGTTGCTGCCTATGGCCGGACTAGTGTTCGTTCTCGGACTGAACGACAAGTCGGAGTTCGTGACGGGCGACAGCAAGTACTTGTTGCTGCA
GATCGTCGGTTTGTTGCTCTACTTCTTCGCTGGACTGGGAATCACGTCTGTTCCTTGGGTGTCGTGCGTCGGTCTGTTCACCACGAAGCAGCGCGCAGTG
TATGTGACCGTCTACTTCATGGTGTTCTTCCTGTTGCCCGTGTGCGCCACGTACATCCGCTCGAACGAGTCGATGAGCGGTGACCAGTACATCTACCTGT
TCGCGTTGACTGGCTGCTGTGTGGTGGCGACGGCGCTTCTCTTCACTGTGGGAACCCTCAAGAACGGCATGGTCTGCACCAAGGGCGAGATGGAGGCCGA
ACGCGCGCGTCTGCGTCGCATCCGGGCATCCCGTCGCAGCGCCCGCACGCCCGGCAGCGCGCGCTCAAGGAACTTCAGCCGTTCGCGCGCAAAGTCGCAC
TCGAACTACCAGATGTACGAGTCGCCCGCTGGCAGCGCGCC