Description :
From Genome Similarity Track
Location :
Scaffold_38:57205- 59072
Transcript NameFunction/comments
Hyaar_Emoy2805342DEAD/DEAH box RNA helicase putative
Hyaar_Emoy2805343unnamed protein product

Sequence
1867 bases(100 bases per row)
CTTCACCATCATTTGTACACCAGGTGACGAACGCTTTACCGACGAGTGTGCACCTGCAGCAATCTCAAAGATCGTCTGAGGTGGACGAAACGAAAGCAGC
GAGTCCACGTACGCTGCCTTATCAGCCTTGGTTTTGTCAAGCACGTATTCCTGCTGAAACAAAGGGTGAACCTTCTTCACTGCAAGTTCCTTCCCACGTC
GAATGGAGAGTTTCGACGGGTCAGAGCGGGTACGTGCGTAAGCTTTGTAAGCGTTGTCGCAGACCTTCACGAGCGGAGACACTTGCGGATGGCTAGACAT
CAGCTCCGTGATGGCTTCATTCTCTTGATCAATTAGTTCATTAGGAAATGCTCCATAATGAACATCTGCAACCTTCATAGAACTCAGCGAATACGGCTTG
GTGCCGGCGTGTTCCTCTGGTGAAGAATCCTCCAGTCGGCGCCCGATGTAAAGGTGCAAGTCAACCATAAATGGAGTTTCATCAGGATCCACAAAGCTGA
AAGCTGTACCACTACGACCTGCACGAGCTGCACGACCCACACGATGTACGAAAAGCTTAGCCGTAGGCGGAAACGAGTAATTTAGCACATTATTTAGCAG
TGGAATATCGATACCACGAGCTGCCACATCTGTCACAATGAGCAAATCCGTCTTCTTGGCACGGAACTTGCCCAGATTTATTTTACGAGAGGCTTGATCC
ATGTCACCATACGCATATGATGCCTCAATGTGATTCGCCGCCAACAAAGCATGTAGAAACTCTACGTGATGACGAGTAGCCGCAAAAACAATCGTCTGAT
CACCCTTGGGCAAAAACTCTCGGACCATGTACAGGAACAGTGCCGGCTTGTCCAACGATCTCACCGTAAAAAACGCCATCTTTAGGTTCTCCGAGATCTT
GTTCTCCACATCCAAGCGAATCAGCTCAGGATCACACAAGCCAGCCCTTGCAAATTGTACGAGAGCCTTTGGCAACGTTGCCGAGAACAACAGCGTCTGT
CGGCTCGTGGGCATATTCTTCAAGATCTCCTGCAGCTGCTCGGCAAAGCCCATCTCAAAAATACGGTCCGCTTCGTCAAAGACCACATACTCGATAGCTT
TCAAATTAAAGTCAGGGATTTCCTGCAAATGGTGCATCAGTCGACCGGGTGTCGCAATGAGCACGTCCGGGTTCGCTGCAATGGCCTCAAACTGCTGGTC
CATGCCTTCACCACCAACAATGAGCGCCATCTTGAGTGTAGTAAATTTAGCCAATTGCTTCGTGAAGCGAAGCGTCTGCACTGCCAGTTCGCGTGTAGGC
GACAGCACCAGCGCGCGCACGCCAATCTTGGTCGAATGCTCCTTGAGTTTCTCCACCATCGGGATCAAGAAAGCAGCCGTCTTGCCTGATCCAGTCCGGG
CCATAGCAACGCAATCTTTTCCAGACAGCGCGATAGGCAGCGACTTGCGCTGGATGGGCGTAGGCACTTTATAGCCCATGGCCATGACACCGCGGAACAC
GAGCGGACTGAGGCCCAAGTGCTGGAAACCACCTACCCCTGCACCTTTTCCATTGCTCTTTCCATGCGTCGTAGCAGTATCAGTCTTACTAGGCGCGTTC
TTCTTGTTCTTCGCTCCTTTCTTGAGCAAATCGTCTGCCGCCATTGCTCCGAGTGCGGTTCCTGTCGATGGACGTCAAGTGCGGACGAAAAAGCACTGGA
AGCCAGCGAGTGGCTTTGTCGTGCGTTGATTGGATGAAATAGATCCTTATTAAAATCATTAATTTTAAGATTATTCATTTTTAAACCCTACCCCTTATAA
GCGTGTGCTGTGTCGTTTACTACTACTACTTCATATGTCGCTGCGGGACCGCGCCGTGACGCGGGAC