Description :
From Genome Similarity Track
Location :
Scaffold_23:57200- 61544
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10738hypothetical protein
Phypa_INRA-310PPTG_10739hypothetical protein

Sequence
4344 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACTCAGTGACGTATCGGTCGACTGGGTGCAAGAAGTCGCTCAACAAG
TAGACCGCCTGCTGCCCGGAGGCATCAGCGTGCTGGGGCTCTATGTGGTTTCGGCTCGGGACGTACTGTCGAACTTGGTGCCGTACCTCCGAGCTACAGC
GGAGGCGGTCGCGTTGCCCTCCAATGTGATAGTGGGCGAAAATGTCCACTACCTTGCACGTGTGTCCCCGCATGGAGACATCTCCTTCCAGAGTTTCTAC
AACGTGGTGGATGTCAACAAGACACAAATGCTACAAGCGGAACGCAAGACCTCGACGAAGGATATTAAATTCAAGCAGTATCGAACGCTGATCGATCTCG
ACGAACCCACCCCGTTCATCAATGTCGCTCCAACTGCTGCCATGACTGCAACGGAGGTGGCTGAGAAACGCATGAACGAGGTGGAGAGCCAAATGAAGCC
GCTGTTCCGACGCGTCGAGGATGCCATTGCCGTACCTAAGCTGACGGGTGATACGAACGCTCAGCATATGAACCTGCTGACGTTGACACCCCCGGAAGCT
CAAAAACTTGTCGAGGATGTAAGTGCGACGACGAAGTTGAACTCACTATTGGAATATTGATTTTCTTTTTTGCTTTGTTGATAGCCGCTTGGTGGTATCC
ACGGAGCAATTAGTTGCGTCGCGTTCGTATCTCAAAGCGAACCTGAAGCCAATGAGGTGGCAGCGAAGTACCTGAAGCGAGACTTTGTCAAGTCGCTGCT
GGTACGTATCGCTTTAGCTCGGGAGAGGTGGGCCGAGGATGATGAAGGTAAGCACTGATACGCTTGGCACTTGTGTCCAACACAGAGAAATCAGGCTCTC
GTTTCTGACCTTTTGCTCTGGATTTTGTGAGTAGTTGAGCCAAACGAAGTGTTCAAAGAAGGTGGTGTCATTCGACTTGCTCAGCGAGGTTTGGTGCCAT
GGCGCTCCACTGCCGGATTGAGTTCCCATTTTTCGGCAGCGGTTCATGTTTTTCCCGACGAAGACACAGTAAAGGCGGTGGAGAACGCATTGGAGATCCT
CGGTGGTGCCTCAGGTAAAGATGCTGCTGCATGGGCTGCGATGGAGATCGGCGGACAACTTGGCTCTCCCATGGATCTTACATTCGGCGTGACCGAGTCG
GAGCATTTCAAGTACGTTTACTATCTGCTACCGGTGGTCCTCGTCCTGCTTCTCGTAGTAGCCCAATACTTCATGTGATAATTTTTACGTGATGTTTGTT
TTTGTTTAAATTTGAGGCAGTAGTTGCAATGGTTTAAATTTTGTTGCATTGGACTCGATTTACTTTTACAATGTCTTGTGTACATCTATCTAACATCGAT
TCTATCGTATATATGGCGCGTGGTCGCATTCATATGCGAGCGCGGTTTAATACATAGCGCTGAAGGCCCACTCAACGTTGCTAGCCTCGAGAATACGCGA
CTCAAGGCCGAACTCAGCGAACGTCTTGCATTCCGTCTCAACGACCTCCAAGCAGTCGTCCGCTTCATCTTCAACAGGCTCTTCTTGTTGCTTCTCTTCT
GTCTGCTTCTGCTCTGCCTGCTTTTGCTGACGGTGTTCCTGCACGGCATCTTTCATGGCGCGGATGGTGCGGTTGACCTTCTCGAGGTAGACCATGTTCG
ACTTGCAGTCCACGGAGCAAAATCCCGGGTGCTGGCTAAGCGTCTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN