Description :
From Genome Similarity Track
Location :
Scaffold_23:572- 9535
Transcript NameFunction/comments
Phymu_g1477conserved hypothetical protein
Phymu_g1478hypothetical protein PHYSODRAFT_492337
Phymu_g1479hypothetical protein PHYSODRAFT_350782
Phymu_g1480conserved unknown protein
Phymu_g1481alpha-N-acetylglucosaminidase (NAGLU), putative
Phymu_g1482hypothetical protein

Sequence
8963 bases(100 bases per row)
CAGAGCGCGGGCGCGGCATTCGCCCGTTTGTAGAACCGCCTCCATTAACTGCACAAAGCAGATGATTCTAAAATGCGGCTGGGTGCGTCAGCGTCAGCTG
AAACTGCTTCGCAAGCTGGAATTTTGCCGCTGGACTCGAAAATGCCTCCAGCGGCTCATGCCTGGCTAAGTGTTTACAGCCGTGCGACGTTCattgctgg
cgctgcatgtACCATGTATGCATTGGAATCCAATTTGGATGTCTCTTTGGCTTTCAAACTTTGACTCTTCTATAGCCAATTGAAGTATTTTTATGATTCA
GCATCTTTGTCCAGCTCTGCCAGTTCCCCCATCCCCCGCGCTCTATTGAGGACGACACAGTATCCCCTTCAACGCGTTTTCAATGCGCTCACTTCGCGAT
TTCCCCACAGTCGCGTACTGAACGTTATTTAGCCAGGAACAGGTCTGCTACCATGCCGCTTCTGTTGCGGCCCTCAGCTCCCAGCCCCAGTATCGATGAG
CTCGCCTTCGCGGTGACTGCAGCCCCTCTCTCCACACAGGCGTCGCAGCGGTCCGTGTCCTCCGCTGTGCCTGAGTTGCCGCGGTGTCCCACACATGGAC
GGCTCTCTCTTCGCCGCCGTCGCAGCACTGCAGGCACAGAAATGGAGTTCACCGACAAAGACTCAGACTTGATGCGGCGAGCCAGCCAACAGAGCATTCA
ACGTAGCAGTGGCGTTCTCAAGGCcacgtcggagctggaggcgtaCCGCGATTCGAAGCGCTCGTCGCGGGATACGCAGCCAGACGACGACCATTTGTCC
AGCGACGGCAGTTACGCCTCCGAGGCGGAGCGTGTGTCCAGTGTGCtgagctgtggctgctcgtgCGCCGATGCGAACGAGCTTGCCATCACGTcctccg
tcgtcgtcattgaaGACCGCCAGCTCGCCGTCGTGGACAAAGAGCTGCGCGACTTCCGCAAGACCCTTGTGCGTAAATTGTACTCGCGGCTATCGAAGAT
CTCGGGCTTCGGACGCAGGAAGTCTACCGCTGCTAAACCAGTGTTTTAAGCTAGCATTTACTGGACATCGGGAATCCTGTAGGTGCAAACGCGTCAACCC
TCGCTGTCGGACAGGCGGGGTGGCTAGAGTTCCTTGACTCACGTTCGTTAATATTTATAAAGAAATTGATTTTGAGAACTTTCGTGACTCCTTGGCCAGG
AGTCCTGGCACAAGGTCATAACGCTGTGCTGCATCTTTAACGATCATGCTCACGACTCGTTGCGTTGGACAGGTGGGACTAACTTGTCGCTTTGCCTCCC
TAGAGCATTGCCTGGCGTGTATCGAATCAATCGACAGTCCCTCCCTCAGAACCAGCCACCAGCAGTTCACACAGAAACAGAAGGCAGCGCCAGTCACGTT
TGGTTTCTATTGAAGGTCTGAGTCAGAATTATTTCATTCGAGTAAGTGGCGAACGGCTTCTTCCGCCGCGAAACAACCATGGCACGAGCTGGCCATTATG
CGTCGAATGGCTTGCGGTTGGAACGGCGGACGTGCGCTTGATACATCATCGTGAACACCAGCGACAAGACGAACACGAGCGCCACCACAAACGCAATCAC
CTGCGACCGCATTATCTGCCGCAATAACAAAGCAATAGCCACATGTGTCAACACAATTGGACGAGCTACTAGCGGCATGTATGAAGCGCTGTGGGACGCA
CCCggttggcgctggcgtccGCGATCTCCGACGGTTTCTTGTGTTGGCGCTTAAGGCGCTCGCTCATCTTGGAGTAGCGTTCGCCACTGTAGATGGTGGG
GCCCAGCGCGACGTCCACGCCACGCTGTCCCTGCTTGGACGCTCCTGTGCCTCGGTTCCGTAGCTCCATCGTAGGCAAGGTAAAGTGTTGAGGCGGGTCT
CCAGTTAAACGGGTTTCCGTGAAAACCCGGCGCTGAATCCACGGGTTCTGATGTCAGTGCGTCCCGTCTCAGTGTTTTTAAAACAAAATGAGGATTGGTT
AAAAATAGGGTAATTGGCTCATTAAGTTCTAGTCAAAATAATAATACCCTTTTACAAGTTCGCGCCCGTCTCATGGAATATTGGAAAGTTATGATTGGTT
TAAAACTTACATTTGAATTTTGGCGAATCATATTGACTTGAAATGTCGCGTGAAAGTCTCAAAGGGCTCATCGGCGCTTCCCACCATCGTCGGTTCTTCC
CTGCGCTGCCGGAAGCTGCGTCGCCCCTGAGCGTGGCCACACCTGTACCTGCAGAGCTTCCCCCCCCTCTCCCCCTCTCTTATCAACGTTAATTCTGCCA
GTATGAGTGAGTGGTGGGCAACCATCGGCCAGCCCTTCGCCGAGGTGCGTGGCATGTCTTTGCGCTCTACCCCATGGAGCTCCTTACACCACAGAGGCAA
CGGCTGATTGTGTGTGCTAATTACTTATTGCCAGGCGCTGCTGAGTCTGGACACCGTCAAGATCAAGGCGGCTTTTGCTAATGCCCCCAGCTCTTACTAC
GAGTACATCCGCTCTATCTACGAGCGCAGCCCCGAGCACGTGATCATTGAGACGTTtctcatcgtcttcgtcatctaCATCACCTTTGTCAAGCGCGACA
AGCCAAAAGGAACCGCTGCTAAGCTCTCGGAGAGAGAGATTGACGACCTGTGCGAGGAGTGGACCCCTGAGCCCATTATCCCGCCCAATGCCGTCGTGGA
CGTCAACAAATCCAAGCCGATTGGCATCGTTGAGGCCACACCCGACACGCACATCAAACTGCAGGGCTTTGCTAAGCCTCTGTTCAACCTGGCCACCTTT
GACTTCCTCGGTCTGGGATCCCGCCCCGAGCTCAAGGAAGTTGCGGTCAAGACGCTAACCAAGTACGGCTGTGGCTCCTGCGGACCCCGTGGCTTCTACG
GCACTATTGACACTCACGAGATCCTTGAGAAGGATATCGCGCAGATGATGGGAACGACTGACTCAATCACCTTCTCGGACACAGAagccacttcctcttc
ggtGCTGCCGGCCTTTGCCAAGCGTGGTGACCTCATTGTTATGGACGACGGCTGCAATGACTCGATCCTCGTGGGCGCCAACCTGGCGCGTTGTACGGTG
CACTACTACAAGCACAATGACCTGGCTGACCTTGAGCGCGTGCTCAAAACGGTGCGTGACGAGGACAAGAGAAAGAAGCGTGGCTCGGACTGCCAGCGCC
GTTACGTTGTGACTGAAGCTCTTTTCCGCAACCACGGTGATATGGTCGACCTGCCTAAGGTCGTGGAGCTCTGTAACAAGTTCTTTTTCCGCCTCTTCCT
TGAcgagagcttctcgttcggcGTGCTTGGCAAGTCCGGACGTGGCCTTACGGAGCACTACGGCATGGACGTTTCGGAAGTGGCTATCATCTGCAGCTCT
CTCGCCGGGTCTACTGCAAGTGTCGGCGGCTTTAGCACGGGCTCGCAGGAGGTCGTGGACTACCAGCGCATTAACAGCGCCGGCTACGTGTTCTCAGCTT
CGGCTCCGCCTTTCACGTCGGCTTGTTGCTCGGAGGCTATCCGCATTATGAGGGACGAGCCGGAGCTCTTCACTAAGCTCCGCGACAACGCCAAGCTCGC
GCACGACGCGCTGTCCGCCGGCGTTCAGAGCGTGTACAGCGTCTCCAAGGCTACTGTCTCCCCGATCCTGCACCTACGTCTGCTTCCTGAAGTCGTGGCT
CGCGTTGGAAGCGAGGAGAACCAGCGCGCTCTGCAGCGCAAGGTGTGTGATGCGGTCATGCAGAAGTGCCTGACCAAGGGCGTGGCGATCTGCTCGCCTC
GCTACAAGACCCACCAGACGATGGAGCCGCTGCCCAGTCTGCGTGTATCCGTGACTGCCATCCATTCCCCtaaggagctggaggcagcgTGCAAGGTCAT
CGCGACGGAGGCCATGGCTACGGCCAAGGAGGTGCTTGCCAGCTTCCCGGTGGACGCTGTTCCTGCTAGCGGACTACGACAGCGCAAGCAGTAAGTAGGC
GACAAGTGCCATAAGAAACAAACTGAGACGAAAGAGCTAGCCTCTCTGTCTAATGAAATGCTCGACGCTTGCAGTAGTAGTTCTGGTGGTTCAGTGACAT
TAGCATTAGGCCTTGTAGGAACATCTAATTGGCCTTCTCCTCATCCGTCATCTCCCTCTCGCGCCTCTTGCGATAGATTTCGAACTGCTCGTCATTGGTG
TACTGGTGCAGACAGGCGTTGAAGGCCTTGTTGTGGTCACGGCACTTGAAAACCACCATAAGTCCGTTGGCTTTGGCGCACTCCGCGAACTTCTCCGCGA
CGCTGTGGCAATTGGAGATGGCGATGTCActcagctcctgcttcagttTCTGCAGTCACAACAATGATTAGATCCCTACATGCATGTAATAGCGACTGCA
ATACGCACGTGCTCGGCCTGGTTGCTCCAGGACAGACGCGACGAGCGGAACTTGGCCTTGGCTGTCTCCTTATCCACAGGTTGCTCCATGGTGACTTTGA
GGTGTGTGTGCCTCCGCGTTTCCACGCAGTATGGTGTGAACCACATATATGAAGCTATCATTACGTTCCAGCATGTCAAAaagaagcaacttcaactttg
ccTAGCTTAGCCGTTACTTCAGAGTTCCTCCAGCACAAGGTGAGATACCCATGGACGGTGTTCTAGACCAGCGTATTCATCGTAGATACGCTGGGAAACA
GCAAGAGTATCACCAACGGATGCAGTTGGATAGGACTCGAGACTGAGCTGCCACTTCAGCTCAAACGCGATGCGagacttcttcagcacgtcgtcgtcca
tcttgCGGTGTTGAGTGTACGACTGGCAAACCTCTCCGAGCCACATACGCCAGCGAGGCAAGTAGTAGCCTTTGACTAGGCCAGCCCACTCCTTGCCGGC
GTAATCGTGAATGGATTCGGAGTTGTTATCGCCCCATCGAGTCACCTGGTTGCGAGCTTCGTACTCGTAGTATTCTTGGAGGTAAGTACTACCATTTGAT
CCAGCAAGTGCTCGTGCATCAACTATCCAGTTGCCAAGTAGAAAATCATCGCTCGTCGCTAGAATCTCGTCCAAATGCTGGATCGTGAGTAGTATGCGCT
CTGTCCAAGCGCACAGCTGATCCGCGGGCGTCGTCTTGCCCTCGTACATGTCTTTCAAGTGGAGATATTGAGCCATGAAGTGGTCACTTAGAAACTGTCT
TGTGACGTCCACCAGATCATGGCGGTACGTGTCCACAGCATGCAGCGCCGTTCCAGCAAAGAGAAGCTCTTTCCAGGCTCGAGTTACATCCATGGGGTCG
TACGAGATCAAGGTCGGCATGAACCCATCACGGACGAGTTTCCAGTGCGGAATCAAACAGATTAAGCTCTTGGTCACCCCACCGAAGCCAAGAGTGCGGT
TGTACACCGACTGCAATAGAAAGCCCCAAGCCCGTTCAGTGTGTGCATCCATCGAGTGATATCGCTGAGCTGCAAAGCTTGGAACCCACTCGTCCATATC
GAGTGGGGTGTCCACCCACGCCATCTGCAACGTGAGGTCGTACACCACGTAATTCTGGTAGATGCCTTCCATTGTGAGACCAATACCGATCATGGTCCCA
TTACTGTCGCGGTTCGCTAATACGGGAGCTGACCCAAGTGTTGGCAAGTCTCCACGCATCCCAGTATTCCCACCAAAGTTGTGTAGCACGCAGTAAATCC
AGCTTTTTCCGAAATAGTTGTCCATCTTGTTCCATACCGGTCGAACTTCGCTGTACAGGTCGAGAATGATCATCTTGTCGTTCGGCACGCCGGCTAGATA
CGCCTTCACATGCTCCTTCGTCCAGTAATCCGGGCTGTTCTCGAAAAGCCACCCTTGGATAAGCCACACGGCATTGCGATCCGCAGCCGTCATGCTGTCA
ATTACGGCACGTGATGCGGCCTTAAGCTTTGCCGGGTCAGTGAAATCTGGATCCATTTCGTTGTACGTGTCGCACTGGTAGAGCGAAGACGTGTAGTCGT
ACAGCGCACGCTGCTCCTCGAGAAAGGTTTTGCCTATTTCGTGGTAAAGTGGATCGGAGGAATCCAACATGTACACACAGCAGAACTCATCGGAGAAGTC
ACCCCAATTGGGCGAACGCGTGAACTTTGCGGTTGGGAATAACGTCCTCATTTCCTCCGGAACGTGACCAGCGAACGCCGGTAAGGCAGGCACCATTCCG
AACTCGCGCATGCGCTGCAAGATCTTGAGCTGTAAAACATGTTGGCCTTCGATAAACTCTTGTGGCAATGGTCCTTTCACCCAACTACCGCGGAGATTGC
CCATACGGCCCCATGCTAGAAACCCAGCGCCAGCAAAGAACTTGTTCAGGCCCGCAGAGCTCACATTGTAGCGCTTGAAGGTGTTTTGCCACGCTTTTTC
TTGCCCTGTGAAAGCCAGCGGCATGTTGATCCCTGCGCCCGTAAACATTAGTTTCAACTGCAAATTAACATTCCAATCCCAACTAGATTTCCACACCGTT
TAGTGCCATCCAGTCGATGTGCCTCTCCCACTGCGACCAGGCCCACGTCCATGACGAATAACTCACGGTACAGACGTTCTGGTAGTAGGAGAACTTGGCG
CTGCGCTTGTGACGCACacgcttctccaccttgggCAGTACTTTaggcagctgcagcttgtggtTGTCCCAATCCGTCTGTGTGTGCAACACCGACTTCA
AGTACCATTGCAGGCTGTACGCCATGGCGGTGGCCGAGTTAGCTGCAATCTCGAGCTTGTCACCGTCATTGCCGAGTTCAAACACGTCGAGATCATCCGG
ATCCGACGGAAGAACACGAAGCGAGATCTACAACAATAATTATTGTTTTTAGCGATCTTTAATCAAAAGGGTCAGCTAAGAGTTAGGACCTGGTCATTGA
AGCGATCGCCGAGGCGACGCTGGATGAGGCCGCGAGTGGCTGCCGCCGCATCATGACTATCTTCCGCTCTCTGTTTCAACAGGTCAATGGACGCATCTAC
AGCCagaggcagcaacagcaagagaAGGAGGGAGATTCGACTCGGTATCATGTCAGTGAATCTCAGATATGAAAAACTCCTTCAAGTTAGGACCTAAATC
AAAACCCCCAAATAAGAATAAAATCACACCTAAATCGCAGTGACGTAACGTTTCCCCCCAAACAAAGTCACAACGCGAAGCAGTTCTCTCTCACTTCCAG
ACCAGAACTCGCGACGACACAGCCAATGACTCTGCGTAAACGACGCTCTAGCCCCGAGGGCAGCCCCAAGCATGCGCAGAATGCGACTCCGCCACCTGCC
AAAGCCCCTGGAAGACTCACCAAGTTCATGACGCGTGTCATTGTGGGTTTTGCCATGATCGGCGGCTTCATTGCCATCCTGTACGGAGGACACATGTACG
CCTGGGgcctcgtggtggtgctgcagacgctgctcttccgcgAACTTGTGAACGTGCGCTACCGGGCCGCAGCAGAGAAGAACATCCCGTGGTTCCGCTC
CGTGCAGTGGATGTGGTTCATTGTGGCACTGTTTTACAACTACGGAGACTCGCTGGGAGGCTTCATTGAGAGCAGCAAGATCCGCTTCGTGCCGCCAGCC
ATCGTGCACTACCTGCGCTACCACACGTGGGTCTCCTTCACCATGtacgcgctgctcttcgtcatGTCTGTGCTCAGTCTTAAGAAAGGTGAGACCGTCC
GATTGTGCAGTCGTGCAGTTGCAACTGTACGTTGCTCGTTGAATTGATTGACTCATGTGTTGTGGCTTGATCGACTAATGTGCAGGGTACTACAAGTATC
AGATGGGTACGTTTTGCTACCAATGGAGTTAAGTGTGCTGGGAGAATATTGACGTTTTGACGTATTGTTGCAGGCCAGTACACATGGACTATTGTGACGT
TGGGACTGATCGTCTTCCAGATGAAATACGTGCTCACGAATATCTTTAACGGTAGGAGGAAATGGGAGCGTAGTTATTGTTCGGTATTTGTACTGACAAA
TTCTTTACAGGCCTCTTCTGGTTCCTGTTCCCTGTGTCGCTCGTGATCTGCAATGACTGCTTTGCGTTCTTCTGTGGGAAACTGTTTGGCCGCAAGTTCA
TTAAGACGCCCTTCCTGCGGTTGTCCCCGAACAAGACATGGGAGGGTTTCATTGGTGCGTTCATTTGCACCATCATCTACGCATTCTTCTCGAGCGCCTT
CATCTCCCAGGTAACCAACATTTCACCGTATGGATATGTAGTATCCTTGTACTAATCCGTGCTTGTGTCTTTTGCGCTTCAGTTTTCTTGGTTGACCTGC
CCAGTGGAGAGCTTCGAGGTACGACCCTTGATTTGCCACGAACAATGGCAACTTTTAGCTAATGCTCTCTTTGGTGGTATTTCTTTTCGTGCAGTTCAAA
CTGATCCCCGACCCGCTCACGTGCACTCCCCGTGACGTGTTCCTCCCGCACTTCTACGATGTGCCGGTCTCCATCGCGCGCGTTATTGGGCTGAGCCAGA
TTCAGCTTCTGCCGATCCAACTTCACTCGTTCTGGTTCGCTATTTTCGCTTCAGTTGTGTCGCCCTTCGGCGGGTTCTACGCGTCCGCCATCAAGCGCAC
CTACAACTTGAAGGACTTTGACTCGGTGATCCCGGGCCACGGTGGCGTCATGGACCGGATGGACTGCCAACTTATCACGAACTGCTTCACTACCGTCTAC
TTCAACACTTTCATTCGGTACACCATGGTTAAATGCGGTAAGAGGAGGCTAAAATCTTGCTGACGCCTTGTTTTGTCATTTGCAGTTCGCCGACGCCGTC
CGTGGCGATGATCCTGAACCTCGTGGCGCAGTTGACAATCGCTCAGAAACAAGATGTGCTGCGGGCCATTCAGGAAATGCTCCAAGGTTAGAGCACTATC
CCTACGCAGCCTTTTACCCAACGGTTGCTTCTAGAACAGGAAGAAAACTTACCCAAGCAAGAC