Description :
From Genome Similarity Track
Location :
Scaffold_173:57190- 58871
Transcript NameFunction/comments
Physo_144232gag protein

Sequence
1681 bases(100 bases per row)
CACTTCCTCTGTGCATTGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGTCTACCTGAATCCTCG
GTGGCTCAGGTCTGTGAGCCACGATGGACCGAAGTGAGTTTCCTCACTTGACTGACTCGCAGTTCGAGTCGGTGCGGAAGATGGCGGGCATCTTCGGAAG
AGATGCCCTCCGGAGCTTGGCGGCGGCGACGCCAGCCGAGCAGGTCGAGCGGGTGAGCGCGTTTGACGAGTACGAACGCGGGCTCATCGCTCATGTGCAG
GGAAACCTGCTGGCTCAGATGAGTGAGCCCAATCGGGTGCAGCCTAAGCCTCTGCGGCTAGCTGTGCCTCCGTTCGAAGGGAAGGAAGGTGAGAACCTTC
ACTTCTGGATCCGGGAGACCGAGATCGCAATGAGCGCAGGTCTCATCTCGGCCGAGAACCTTCGAGTCGCCTTCGCGCTCTCCAATCTTGGCGGACGTGC
CAGGACTTGGGCGTATACGCGCGAAGTGATGTCGCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCTTTTCTCCCGGCGAAC
AACGAGTTCCGCCAGCGCTCGCGCTTCCTTGCCTGCAAACAAGGGGGGCACGAGCTGTACGCGTACGTACAGGAGATGCGCACGTTGGCAACCTCGCTGG
TGGGGAACCCACTGTCGGAAGACGTCAAGATGACAGTCTTCGTGGACGGCCTGAAGGTCGGTCCTGCGCGCACGCAGTTGTTCCGCGTGCGCACCGCCAC
TATGGAGGAGGCGATCCAAGTCGCCCTCCAGGAAGAGTACAGCCACAAGCAGGCTGGTGCTCTGGCTGTTGTACAGCCTGTGGTCACTGACAGCGAACCA
GAACCCATGGATCTGAGTTCGGCTGAGCAGTACTCAGCCCGCTGCTACGGCTGCGGCGGACTAGGACACTATCAACGTGTCTGCCCATCGCCTGGGTCTG
GGAAGAAGACCTACCCGAAGACCAGAGGGTCAAGGGGACGCCGACGCCATGCACCGTCAGGTGCTCAAGGGGGACACAACCACCAGTAAGGACGAGGGCT
TTGCTGGGGTTGGCCCGAGTCTTTGTGATGGGTGTACGGAAGGCGTACACCACAGAGACCCGGGGTCCCTTGCGAGCACTGACGCTCGCATTGGTGAAGG
ACAACGGTGGGTTGTCGGTAGTACACGTGAGTGTGCGGGGGTAATGGTATCCCTAGACATGATTGAGTCTGGGACGTCGCGTGGATGTTCGCACGTCGCC
AGATGTGTCGGTTGGAATAACGACACAAGTGCCGAGACTCTGCGAGAGAGTCTAAGCACAAGGTCAGGTCTCATTGACTGAGGCTGGGCCGAAGAAGAAC
CTTGGGGTCCGCTGTGACCCTGGCTGCCGCGCTCGAGGGCGCTGACAGCAATGGAACCGCACATGGTCCCGGACATGGAACCGTACATCGTCCCGGACAT
CGTGCCGAAGCCGGCCCTGGGCTTGGAACCGTATATGCCCTCGTCTTGAGCAAGTATGACTTGACCCTGCGTGCGCCGTGCAAGCTGCACAGGCTCTCGG
TCGAGTAGCGCGACAACGCCTTGAGGCTAAGTCGGCCCTCTGTGTCTGACAGAGCATTGGTGAGTCATGTTCCCACCTCTG