Description :
From Genome Similarity Track
Location :
Scaffold_116:57180- 60552
Sequence
3372 bases(100 bases per row)
CGCAGGAGCGCGAGTATCTCCTTCTCAACCGCTCCGTAATTCAGCTCATTCGGCTTTAGCGTTCGGCTGACGAAGGTGACCGGATGGCAGATCCCCTCAT
ATTCTTGTACCAAAGCCGCTGAGACCGCCCAATCACTAGCATAGACTATCACCGTTGGTTAACGTTCCGGATCGAAATGGTGGAGGATGGGCGTCGTCGC
GATCCTATTCCTTAGTCGCACGAACGCGTGCTGAGCTCGGATCCACCGAGGCTCCACCTTTTCCGAGCTCTCCTCCGTCAACTCTGTCAAGATTGGATCC
TCTCCCCGTTGGTCTCGGGATGGATCCAGTTCCTCTTTAAGGTCGTCTTCCGGCGTCGTACTACGTGGATCTCCTCGTGGATCTGGGATCTCTAGGGCCA
GAGCTTGTTGGATCTTGATCCGGACAGCCGAAATGGCCATCGCTGCAAAATCACCTCCCTTAATTCATAGAGTACTGCGGCAAAAAGTGCGTAATCCTCG
ATGAACCGACTGTAGTAGTTCAAACTATCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCTGCCAACGAAGACAGGTCCTTCGGAT
TCGCCTCCAATCCCTCCTTGGAGACTCGATGACTTAAGTAATCCACCTTGTGCATCCCCCAATAGCTCTTCACCACGCTGATAGAGAGATTCCACTTAGT
ACACGCCTCTAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGAGATAGGATCTGCGTCCTAACACTGAT
GGAGTCCCCGGATTCCCTGGCTCTCCTGCTTAGAATGGATCCATTTCCGTATGACTTTCCGCGGCTCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATC
CATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGCGCATTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAA
TGCGGATATCGCGCGAGCTCGATCCGCCATAGCCACCACCCAGAAACCACTGGCCATATCTAGAGAACAGTACCAGCGTACTTTATCCAAATCTTGCAAT
AGCTCATTGATTCGAGGCATCGGATACACCATCAATCGAGTCAGAGCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGA
TGATGATTACCACTGGGGATGCCCACGGGTACGTTGAGAAACTGATGATTTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTG
ACGCGCCACCTTCCGCACCCTTTGAGCGATCGGCTTCGCGTCACCGACGTCGATGTCACATTTGTCTCCGCGTGCAGCTGGTGGTAATTTATCCCCCTTG
CCAATTAGCAGATGGCGGCTTTCCCAGATCTTCTGGCGTAGCTGATCCACTTCCGCGGGTTCGTTCGCCCTCCGGATCCACTTGGGTATCATCAATCGTG
ACATCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATACCTTCTCCAAGATCATCGGCGTGTAGATCCCCGCCTTCATGGTAGCAGACTTGTTCAT
CTTCAGTCTTTGTCGGATCCACCACTGGATCCAAGCACCGCGACTCTTCTTCTCCCGTCATTCCTTCTGTCTTCGCGGGATCGGGTATCCTAGTACCTAG
GAAACTACCTCTCGGATCGGCTTGATCCTCTAGTGAGTTTACACACGACGGTTCCTGTTTAGCCAGTGTTGCCACTTTCGACGAGGATCCAGGCACTCTG
TCCAATGGAGAGCTTGGATACAACTGTGGGTCAGCAGGATCCAGCGAGCCGGCTTCAATTTTCTGCGGTTCCCCATCCACCGACCCTGGGTTATCTAGGG
ACCGGCTCTGGGTATCATCCCCGGTCTTAGACCCAATCTCTACTACTTGGATCCCAATCCGACGATCCCTCTGTAGGATTTTTCGCGGAGCTGGGTATGA
AGGCCAATCCACCAAGGGACCAGTTGGCTCCGCCGGGAGCTCCACCTCCCCGAGAGATTCGATCTCGGTAGTCGCCTCATACGCCAGATTCTTCCTCCTC
TGTAGCGACGGGATCCCACTGATACATATCCAGGCCGCCTAGGGATATCATCCTTCGCCAGCCATCGCCCAATTTCTTCATAGTGGTCCAGTAATAGTCA
CTTGTCGCTGGCATTCGTGACCTGGAGGTACTGTGATCGACCTGGTCCTTGGATTACTGTAGGCACCCACTTCTCACCCCGAGTGACCCACAGCTTATCA
TGTTCCACCCACTTCAACCGATCTGGAAGTTCCCAGGTCTCTCCGGGCTCGGTCCAGGTCGTCTTATCCGCCCTTATGATTATCATCTTCTCCCTGTAAA
ACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTTGTCCGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGCATACTAGAAATCTTGGCTAACTGACACTTCCATGTAGACACGTGTATTATCGACTCGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTC
TTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTTGTACCAGGATTCAAAGCCCGGCGAGCGTCCTAGGCTAACATCTTCTCGGCCACTTCT
GGCAACATCCCTCTGTGCTTGGGTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCCTCCATCGAACACTTGCCGACGTCGTGAATCTCGCCACACC
CGCGACACACGTAGAAGCAGTGATCCCCGGGACGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCC