Description :
From Genome Similarity Track
Location :
contig_3:57172- 59913
Transcript NameFunction/comments
g732.t1hypothetical protein

Sequence
2741 bases(100 bases per row)
ACGTCGCAGTACACGTGGTGGAGCTTCGTGCCTGTGTTCCTGTACCTGACGTTCCAGAAGACGGCCAATCTGTACTTCCTGCTCATTGGCATTTTCCAGA
TCATCCCGTCCGTCTCGCCGACGGACGGCGTGCCGCTTCAGTTTATCCCTCTGGCTATTGTGATTATCATTGACGCCATCTTCGCTGGCTACGAAGACTA
CAAACGGTACATGGCCGACGACCTCGCCAACTCGGCCAAGACGCGCGTGTTTAACCGCCAACTGCGCGAGTTCGAGGAAGTCGAGTGGCGCGAGGTGAAG
GTGGGTGACTTTGTCAAAGTTGCCAACCACGAGATCTTGCCGGCGGATATCATGATTATGGCGGTAATTCCTGCGGAAGGAGCACGCTCTGGTGGAAACA
TGGGGCTCTGCTACGTCGAGACGAAGAACCTCGACGGCGAAACCAACCTGAAGCTGCGGGAAGCACCTCAGCCCACCCGCAATGTTTTCATGAACGAGGA
TGAAGCCGGGTTCATTGTTCAAGGTTACGTCGAGAGTGAACTCCCGAACGGAGATATCAACCAGTACTCGGGTACGATGTACTTGGAGGAGAACCCGAAT
GGAGGGAGCGCTGAGGGAGTCCCTCTTTCGCTGAAGAACATGCTGCTCCGCGGCAGTAAGCTGCGAAACACCAGTTACGTGTATGGCTTGGTGGTGAACA
CGGGTGTGGACACCAAGATTATGATGAGCTCTGGCGATGAGTTCCCCGTGAAGGTCTCGTCTATTGACGAGATGACCAACAAACAAGTGATCGTCGTTGT
TGTGATTTTGATTCTGATGTCGCTCGTCGGTGCCATCGGAGACAGGTTGTGGATGGATGGTCTCAACGTGCCGGAGTATTTGCATTTGGACGGCTGGGAT
GACAGCTTTATCGAGACGTTTGTATACTTCTTCACGACGCTCGCCTCAATGGTGCCTATCACGCTCTACGTGTCTATCACTCTCGTGAAGGCCTTGCAAG
GGTATTTCATGGAGCGCGATCTTGACATGTACGACGAGGAAAGTGGCACGCCGGTGAAGGTTCGCAACATGCAGCTGAACGAGCAGCTAGGTCAGATCTC
TCACATTTTCTCGGACAAGACGGGCACGCTTACTTGCAACAAAATGGAGTTCCGTAAGTGCAGTATTGGCGGCCGAAGCTACGGCAAGGGTACTACGGCC
ATTGGCATAGCTGCGCGCATGCGTAGTGATTTTAAGGGCCAACCTATCGATGAAGAATCGGCAAATGAGAACGACGCAGATGCACGCGTCGAGGTCCCGG
TCCCCAACGTCAATTTTAAGGACAAGACAATGTGGCGGGACATAGAAAACAAGGACGACCCTCAAAATGAAAAGATTGAGGAGTTTCTCACTCTGCTGGC
GTTGTGCCACGGTGTCCTGATCGAGCGCCTGGACCCAACGGAAGAGGATACCAGTCCGCCTATTCACTACTCAGCTTCATCCCCAGATGAGCTCGCATTG
TGGTGCTAAGTTCTTTGGTTACGAGTTTATCGAGCGCGAACCGGGAAGTGTTTCTATCAAGAAACCCGATGGCGTCGTGGATCAGTATGATATCCTAGAG
GTTTTCGAGTTCGACTCCAACCGCAAGCGTATGTCAGTTATAGTTCAGCGACGAAAGCGTGACGATGAGCTGCGTCAGATGTCTGAAAGCGAGGAAGATG
ACGTTCTGCTTCTCACAAAGGGAGCTGACAGCATGCTGTTTCCTCGACTCGCCCCGATGTCGGCTAACAACCAACGAATCCGCGAGTCTACCGAGAAGCA
CCTAGAAACGTTTGCTCAAGATGGGTTGCGTACGCTGGTCGTGTGTGCAAAGCGAATCGATCCCCGCGCGTGGGAGGACTTTAACGCACGGTATCGTCAT
GTTTCTGCAGACCTCAGCGAAGTGGAGGCCAAGTCTCGTGGAGAGCCCAATGCTCTTGACAGACTTCAGGACGAGATGGAGTCAAACCTGGAGCTGCTTG
GTGCGACTGCAATTGAAGATCGACTGCAGGATGGCGTGCCTGAAACGATGGAGAGCCTTGCTAAGGCTGGGATCTGTATTTGGGTATTGACTGGAGACAT
GGAGGAGACAGCGATCAACATCGGCTACGCTTGTCGCTTGCTGAACAATGACATGGAACGACACGTGATCAATGCGGCAAAGTATCGCACGAAGGGCTCG
ATCCTACGAAGGCTCGACAAGATTTTCCACTCCATTCACGATGCCACTGATGACGCTTCTCGCACGTCAACTGTTGCCGCCCACTCCGTCTTGTCGCCAC
CGTCGGGTGAAATTGAGCACGCGCTGGTTATCGATGGTGCATCACTGAATATGATTCTGGAAGACCCGCTGCACAACTTGCATCTCCTGCGTGTAGCACT
GCTATGCAAGGTCGTGGTTGCATGCCGTGTGTCGCCTCAGCAGAAGGCACAGCTGGTGGAGCTAGTAAAGTTGAACGTTCCGGAGTCTCACACTCTTTCC
ATCGGTGATGGCGCCAACGACGTTCCAATGATCCAGAGCGCTCACATTGGTGTTGGCATTAGTGGACAGGAGGGTTTGCAAGCTGTGAACAGCTCGGATT
ACGCGCTGGGTCAATTCCGGTTCCTGAGTAACTTGATTTTGGTTCACGGTCGATGGAACTACAACCGAGTTGCTGCGCTTGTCGTCTACACGTTTTACAA
GAACATTGCGTACAATGTGTCCATGTTTTGGTACACGCTGT