Description :
From Genome Similarity Track
Location :
Scaffold_241:5716- 8258
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_241-abinit-gene-0.45Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_241-snap-gene-0.13Cytoplasmic light chain dynein, microtubule motor protein
Pytiw_DAOMBR242034maker-piw_contig_241-fgenesh-gene-0.6Conserved gene of unknown function

Sequence
2542 bases(100 bases per row)
CTTATCGCGCTCATCGTGCAGTCCACCGGCATCATGAACAAGGTCAAGCGTCTGCGCATGGACACGCTCTGCGATATCCCGCAGGTGCAGACGGCGAGCC
ACAAGAAGTGCGTCGAACTCTCGCAGCAGATCACCATGTACGCGAACAGCGTCGCGACGTTGCACCAGCAGATGGCCATGACGCTCGACTCGGCGAATAC
GATGAACCCGAACGCGTTCCATCAGAACGTGTCGTCGATCAACCAGTCGATTCAGTTCAACGAACAGTCGATCGCGAGCTGGAAGGAGGAGCGCGATAAC
GAGATCGTGCGCATCGTGCAGTACACGACGGCGGTGCGGGAGGAGCTCAAGCGCGCGTTCCACCAGCAGCGGCCCACGTCTACAGCCTCTTCTTCGTCGA
CGTCGTCCTCGGGCCAACAGCAGCAGCAGTGGCAGCGGCAACAGCAGTAGCAGAACAATGACTATCACAGGTAATGAAGAAATCGGTTGGCTCAACCTGA
ACATTGTGGAAATTGTCAGCAGCGAGGAGCCTGAAGCCCAGGAGAGCGCGAGAAGAAGATCGTCGACGACTCGAGAGGTAAATAGCAACGTAATTATTTA
TTAGGCGCACTGACTCGGAACGGCATGCGGTCGTGCTGATTTCTACCCATGGCGATAGACGAGGAAGCCGATCTGTCCAAGAAAGAAATATAACATGCTG
CTCACCCAGACATACGAGACCCCGAGTCAGTTTCCAGATGACCCAGTACCAGGTTCAGGACAGCAAGAGCGCCTCACCGTTTGACCTCGTGCGAGACGAA
GGACCCGAAGGACTTGCCGACGATGACGTGCCACGCGCCAGTCTCGAGCTCCTCGACGTCCTTCTTGATCTGCTGCGCGACCTCGGTGAAGTGGTTCTTC
TCGCCCTTGTAGAGCGCCTTGAGCGCGTTCGTGGCGCTCGTGAGGATGAGCTCCTCAAGCTCCTGGGACGTGTCCTGGTACACGATCCGCAACGCGCCGA
CCGCCACATCGTCCTTCTTCGGTGCCTTGGACATGATCTGCTAACGTGCTCGCGGTCCTCTGGATATGTTTGTGTGAGTGGTGACTGCCTGGAGATATTC
AGGAACTCAAGAGACCTTTCAGGGTTTGGCTTCGCAGAGAAGCGTCGTTCTGCGCCGTGGTGATGGCGTTGGCAACTGACCGGGATGACAAGGGCTCGAT
GCTCGACATTCTGCTGCGCCACACAGTGCACTGCGTTCTTTTCCAGGATTCGGAAAGTGAGGATGAAGACCGCAAGCAAGACGAAGTCACTCTTGCAGCT
TTACCAATTCTCCTCCTGCAACCAATCGAGAGCACACAGCGCGATGATGGAGCAAGCGTCCAGCATGCTGTCTATTGTAAACGCGTGCTTGAGTCTCAGC
TGTGGATGGATGATCAGCTGCAGCAGGAGACCAAGGCTCTGAAGAAATACCTCCAACAGTACCGCAACCAGCAGGAGGTCTCGACGGAGCTCTACTGCGC
CTTTGAAGCCTACGCGATCGCCAAACTCTTTCTCTTGGAGCGCTCAGCAGCCGATAATAACACGAGCTTCACCTCCTCACTCCAGCAGCAGAAGGCCAGC
ACAGGAAACCGCTTCTTGCTGCTGCTTCACGTGCAGTTGGAGCTCTACAACACGTACTTTGAGCACGCCCAGCAGCGCAAGGTAAGAGCGAACTGGACAA
CGCGACCATACCATACACGTCTACTGATAGGGTTTGTATTTTTTGGCTCAGATTCGCTGTGAAGACGACGTCAAGCCCGTCGAGCACCTCTACGCGTTCT
TCTGCCAGCAGCAGCAGCAGCAGCAATTAAATTCTCAAACGTAGTTGCTGTAGGTCGGCATGATGTCCGTCTTCTTCGAGTCGAGGCACGGGACCGCGAG
CCACGCGTAGTAGAACGCAGCGCCGCCCAGCATGTGCATGCAGCCCTTGAGGAATCCCACACCACTGAGTGCGCTCGCAGCCTCTTCTCCGTTGTTATTG
TCTGCGACTGGTTGCTCTCCCTTGCCACCGAAAACGATCGGGATCGCGCCCGCGAGCACCGCCATGAGCAGGAAGATAATCGCAAGCTTGGCCGTCTCCG
TGTTCATGGGCGCGATCGCCTTGTCCGTTGACAACACGCGGCGGTAGACAGCGGCCGCGAGGTAGCAGACGACGAGCAGCACCTCGTAGATGGTCGAGTC
CCAACCGTCCTTGGCCTTCATGAGCCATGCGAGCGCGAAGGCCACGTAGCGCAGCACGATGTTGCGGTCCTCGTCCTTGAAGCCCATGAGGTGCACGCAT
AGCAGCAGGAAGTAGGTAATGGAGAGCACGTCCGAGATGAAGTGCCACTGGAGCTCTCGCAGGAAGAGCTGCGCCTGGAAGGCCTCGGCTGCATTGAAGC
AGAACGAGATGCAGAGGTGGAAGACGCCCACGAAGAGCTCGAAGTGCCGGTGGTTGCGCTTCATCACGCCCAGCGCAGGTACCATCGCGGCGTCCGTGAG
CGCCAAGAAGCAGAAGCGCACGAGCTCGAGCAGCACCATCTT