Description :
From Genome Similarity Track
Location :
Scaffold_70:57155- 59613
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.10DNA primase
Pytir_DAOMBR486fgenesh_masked-pir_contig_70-abinit-gene-0.73Conserved gene of unknown function

Sequence
2458 bases(100 bases per row)
TCGAGTCATGGTGTCGCCTATCCTAATTTCAGCATCCCTCCTGAACTCAGAAACGTCGAATTTAACTGGATAGATTCGCGCGAACTTAATGAAGGCGTTT
TGTTTTTGCTGTTTTGGCGGGAAGTGCAAATTGCAATCGCGCCATTTTTGCGAGTGGAGAGAGTTTGCTTTTTTGCGGTGGTCAATTGACGGCGCGTGAA
CAGCAACAAGCAGCAGGACAGGACAGGAGAAGCAACGCAACAGCAATCATGCAGAACGTCGGCAACCAACGTCGCGAGGTGCAGGGTATGCGCCATGGAG
GCATCTCCATGCTCTCGATGTACAACGAGCCGCCGCTCGTGGAGGTGTCGCTTGAAGACTTTGAAGAGTTCGCCATCGACCGCTTGCACGGTACGAGCTC
GTGGAGATTGACGAAGCGGACGCATTTGCTAGTAACTATAAGACCTGAAGAGCTCACATGCTTTTATTTGTTTGTGTCGTGGAACGCGTAGTGCTGAAGG
CTGTGGAGAACTTTCGTCTGCGCAGCGTGACCATGAAGGATCGCGAAGTGCGACTCGACAAGACGTTGAACAAGCACTTGCCGCTGCGACCGGCTGTGCC
AGGCAACCCGAAACGAGCAGAAGAGGATGTGGTGCGTTGTATATGATTTAATGTAGTGTGTGATGGTCTCGTCGAGGGTCTTAGCTGGTTACGTCTTTCG
GTATGGCTGGCTGATACACAGGCGAAAGATGAGCTCTCTCATTTCTTCCTGCGCATGGCGTTCTGCCAGACCGAAGAGCTCCGTCGATGGTTCCTTTCAC
AAGAGAGCACGCTCTTCAGGTACCGTCTGGACAAGATGTCGCGAGAGGAGAAGCTTCACTTCATGAAGACGAACGGGCTCTCGTACCAAGAGGCGACTCA
AAAGGAGATTGAGCAGCGACAGAGCAAGCTCAAGGCGGTGCGAGATGCAGGAGTGCTCGACATCAAGCTGAAATTGCTCCCGCTCACGGCATACTTCAAG
GTGCCATTCACAGAAGCCCTCGATTTGGTACGTTCTTCTGTTCGATCGCACTCAAGGTGGTGATCATTGGGCACTCACTCGCAATTCCCGTTTCTGTAGG
TTGGAACACGCCGAGTGTATCTGGAAGGCGGTGTCGCGTATGTGCCATTCGACCATGTCGTGTCGATCTTGCACTCTGCATTCCGCGCTAACGTAAGTCG
CAGCATCACGCTTTCTGTACTCCATGCTGTCGCTAACTAATTCCCTTTCGTTGACAATGAACAGCTCTCGAAGCAACTGGCAGCCGCGTTCCGCAAGTAC
AACCGCTCGCTCATCAGCAAAGACGACCGTCTCGCGCCTGTGCTCTCGAACCTCGCGAAGCACCACATCGACGCGGACTACTCGGTGCAGGCCGCGAACG
TGTCGGCCGACCAGATCACACCGGACATGGTCGACGGGCTTGCGGCGACGTCAATGCCGCTCTGCATGCGCTCGCTGCACAAGGCGCTCAAGGTGAACCA
CCACATGAAATTCGCCGGCCGTCAACAATACGGACTCTTCCTCAAGGCCATCGGCCTGCAGCTCGACGACGCGATCGCGTACTGGCGCCAGGAGTTCTGC
AAGAAGATGTCGGTGGACGATTTCAACAAGAAGTACGCGTACAACATTCGCCACAACTACGGCAAAGAGGGCAAGCGCAAGGACTACACGCCGTACAACT
GCATGCGCATCATCACGGGCGAGCCACCCAAGACGGGCGAGTACCACGGCTGTCCGTTCCGCCACTTTGAGGAGGAGCACCTGAAGAAGGCTTTGCAGGG
CGTCCCGGAGGCCGAGAAGCAGGAGATCGTCGCGCTCGCGCAGGCCAAGCATTTCCAGATCGCGTGCAAGAAGCACTTTGAAGCCTCACACCCCGGATCA
GACGCCGACGTGATGATCAACCACCCGAACGGCTACTTTGATGAGAGCCGCAAGTACTACGCCGCCAAAACCAAGGGCGTGACCGTCTCCGCTGGTGCAA
GCTAGTGTTGTGGGACTGTTGAGGTGTCGTTAACTTTGATTTTTATATGAAAGTTGACTAGGCTATCGCGCGCATGCATGTTGTTGTTGATACATTATGG
AAACCAGAGACAGCTACTCGTGTCTTCTTCCCATTTACTCCATGTCAACTGGCTCAGCTACCATGTCGGCGTTCACCACTTCGCGCATGTACTTTCGGAT
CGCAACGTCGGCGAACTTGCGGAAGATCACCTGAATGTGAGCCCAAACGATCAACATTGTTAGAATAGGAGATGCAAAATGAATGTTGTGAAGCCACGAT
AACAACAGACTCACCAAGCGCACGAGGCGCCTGTCGGAGCGGAAGCTTTGCACGTTTGCCTCGCTTTTCGCCTGCTCCGCTTCCGCCTCGGTTTTCTCGT
CCGGGCCGCGAGCTGCATACAAATACAGCAGAAAAGGGCATTAGCTGTGGTCTGACCG