Description :
From Genome Similarity Track
Location :
Scaffold_10:57152- 60701
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03812HECT E3 ubiquitin ligase putative
Sappa_CBS223.65SPRG_03813Pkinase-domain-containing protein

Sequence
3549 bases(100 bases per row)
CAACTATGACGAGAGCGTGGGTCACATGGTGTGGGGTCGAAAGAAGCACGAACGGACTCTCAAGCGCATCGCCAAGCCGCACGACCATGCGATCGATACG
CTCGAGAGCCACCCGCTGGGCATCCTGCGCGACTCGTCGTCGAGCGTCGGATCCGTCGGCAGTGTCCAGAGCGTCGGGTACATCTCCAAGCTCATTACGT
CGCCGTCGAACCCGGATGGCCGCATGTCGTTCGAGATGGCCGAAGGCCAAAGCGCGTCCCAGAACTTTGTGCACAACGGCGCAATGGTGTTTTCGCCGGC
CGAGCTCAAGACGGTCTCGGGCCTGACGTTCCAGCAAAAGCACGCGTGGTTTGTTCAGTACACGTCGACGATGGAGATTCCGTGGGAGTATGGCCACATG
CTGCTTGAGATTGATCGGTCCAACTTACTGCACAACTCGTGCGAGCAACTTCTGTGGGCGACGCCGGACCAGCTGCACCAGTCGATGCGCATCAAGTTTA
TGAACGAGCCGGGCGTCGACGCGGGCGGCCTCGAGCGCGAGTGGTTCACGCTCATGACGCAAGAGATCTTTGACGAGAGCACGGGTCTCTTCTCATCGTG
CATGGGCCACAACGCGTACATGATCCGTGCGACGTCGAGCGAGGCCAGCGAGGACCACCTCATGGTACGACAAGCAAAACCTTGGTTTGTGGTCAATTCT
CACACCCATATGCTAGTACTTTCAAGCCATTGGGCGGTTTCTCGGCCGCGCGCTCTTTGAAGGCATGCTCATTGACGCCCACTTGTCGCTGCCCATGTAC
AAGCACATCCTGGGCATCCCGATTACGTTTTCCGACCTCGAGTTTATTGACGTCGACTTGTACAACAACCTGCGTTGGCTCAAGCAGAACCGAGGCGTCG
AGTCGCTCTGCCTTGACTTTAGCGTCAGCGTCGCTCAGTACGGCTCTGCGCCATTGACGGTGGATTTGTGCCCGAACGGCCGCAACATTCCGGTGACGGA
CGACAACAAGGACGAGTATGTCTACCGGCGCTTCAAGTGGATCATGATGAGCAGCATCTCGTACCAGCTCGCGTCGCTTGTCAAGGGCATCTACAGCGTC
GTGCCGGCCGAGCTCCTCTCGGTGTTTGACCACCAAGAGCTCGAGCTGCTCATGTGCGGCATTCCCGACATCAACGTGGCCGACTGGAAGGCGCACACGA
CGTACCTCGGCGAGTGCGACGCGATGGTCATCGACTGGTTTTGGGAAATCGTCGAGGACTTTAGCACCGAGCAGCGTGCCCGCCTTCTTCAGTTTACAAC
CGGCTCAGCCCGCGTGCCGGTCCAGGGCTTCAAGACACTAACGATGAACGACGGCCGCATCTGCCTCTTTGCGATCCAAGGCATCCGAAAGGAAGAGTGC
TTGTACCCGCGCGCCCACACGTGCTTCAACCGGTGCGATGCCAATATTGCTATTGTCGTGCAAAAGAAGCTCATCGATCCATGTGTAGCCTCGATCTGCC
CATGTACTCGACAAGGAAAGACCTCGAGACGGCGCTCATGATGGTACGACACGTTCTGATATTTCACTTGGCGATGCTGAAGTATATGCCTCTAGGTGAT
CAAGATGGAAGTCACTGGGTTCACTATCGAGTGAGTCGTCGTTGCTGTCCGTGCTGTGCTTTTTATCTAATATACAAGTTGCCTTTGTGTATCGCTAAGA
AAAACGCAATGGAGCGTTGAGATTCGCGTTCAGATTCAAAAGACGTCGACACATCTCACGCCGGGTCGTGCTCCCAATACACGGGTGTCCTGCCGTCGTA
CGTAAAGCCAAAGTGCTCAAACCCTGGGAGGTCAACTTCCGGCTCGGTGCCCTCCGTGGACGAGTAGTCGCAGCAAAAGTGCTGCGTCGCGGTCGAGGGC
ATTGTCGAGAGGTCGAGGGCGGGTGGACTCATGGGGGGCCGCCGATGCCGCACGACTAGACAACCAGATCCGATTGTATCAACGCAGTATCAAGTTGAGA
TACGTACGAGCCCAATTGATACTTTTAAAGAACGCATGCGCTTTGAGGGTCGACGGTGCCAGCATGCGCAACGTGGCGTCCTACGCGCGTGGGTCACGAC
CTCTGCGATACAAAGAATCAAGTTGTCACCAAGGGAAGAACTAGTTATTCCCTTGGTTGCCACGAACCTTTTCTAGCAGTAGGAAGAGGAGGTCTCGGCA
CGCGGGGCTCACGGCGGGCGCAATGGGCAAAAAAAGATCTTGGTGGAGGATGTTGCGCTTGGTTTCCTCCTGTAGAATCGAGTCTACGTCAGACAGACAA
CATGTCCATCGTCCTCGTACGTCGTTGGTGCCTTGAAAGGGTGTCGTGCCAAAGAGCATCTGAAACATGATGATGCCGAGGGCCCACCAGTCGAGCGCGG
TCGAAGGCAGTGCATTCTGAAACCCTTCAGGGGCTGTGTACTCGCACTCTCCGTCGTCCAAAAGGTCGTTGGCAATGTGCTTGGGCGGGCGCAGCGACGG
TGGTGTCGGGGGCGCGCTTGAGGGCCCTAAATCATACGTCCCGGCGTCTTGCGGCTTGACTTGGTTGGGGCAACAGCACAACTGTTGCCGACGTCGGCGC
TTGCACGTTGCCGCGAAGTTGCGCATCGAGCGGTCGAGTCGCGACGCGTTCCCAAAGTCGCAAAGGATAAGGTGTCCCGTTTCATGCACGAGGATGTTGT
TTGGTGTCAGGTCTACGCCGCGTGTTCACAGTTGTCGTGTTAAGTTCGAGGCGCGCACCGCGGTGGACGATGCCGAGCGTGTGGAGGTACTCGAGGACCA
CGACAAGCTCGGCCGCGTAGAACTGCACGGCGGTCTCCTACGCACCTACTGCGTCTCGAGGTCATCTTGCGTCGCAGTGTACCGATAAATAGCGTGCCTT
GGTCAAGAAACCTTGCAAGGGGCCGCCTGGGCAGTACTAGGAGAGAGTGCTGCAAGTATGCACAATAGTGTCGTCTACTACCTGCATGACGAGGTAGAGA
TAGCGCTTGGTTTGAAAGGCGTAGTAGAGTTTGGTTACGAAGGGGTGGGCGATTTTGGCGAGGATTTCGCGTTCATTGAGGACACGGAGCTCCTACATCC
ACGGCATGAGACGCTTCTTTCCCCCACTGAGTTGGTTGGTACGTAATGCCGGCGCAGGACGAGAGCCTTCTCCATGATCTTCATGGCAAACACGCCGTTG
CTCAAAAGGCCCTAACAAGCTGGTCCAGAAGCTAGCAGCAGTAGCAAAATACCTTGCTCTGGACGAGGTACACGCGGGCGTAGCCACCAGACCGCAGCAG
TCGGAGCTTCTCAAAGTGGTGGACGCCGACACTGTCCATCACGAGCACATGCTCCGCCGTTGGGTTGTACCTTCCGTAACGGCGCCGATGAAACTTCTGG
ACAAGGAGCACCTGTATTGGAGGTGGGTGCGCTTATCACATACCATTGAAGCGAGCAGGTTTCATTGCGTTCGCACCAAGCTTTCTGGTCTAGTACCGGT
TCTCGGTGGCTCTCCGAACGTGCCGAGGGACTTTTCTGCAACCAGTGCA