Description :
From Genome Similarity Track
Location :
Scaffold_57:57146- 58241
Sequence
1095 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCG
GCTTGATCGCCAGCGCCCCGAGGGCTCAAGGCCGGCACGCCGGTCGTCNCGCGCTTCCCGGCAATAAGCTGGGGAGCTGCTGGGTCAGCCACATTGCTCC
GAGGCTGACCCTGAGCCACAGCGCTCACTCCCTCGCTGGAAGGAGCAGCTGGAGTGCTCGAAGGAGCGAAGCGCGCAGCGCTAAACTGGGTCTGCGCCTG
GGCGAGTGCCGAGAGGCTGCGCTTGGCTCGAACCTTTGCGAAATCGAAGCAGAGCTTGCGTTCAATGCGAACATCCACTTCACTGAAGCTGGCTCGGAGT
GCGTCCATGGAGCTGAGCTTTCGGCTGTGCTCGGCCCAAGACTCGAACTGAGCTTCGTACTCAATTGAGTCTTCCCCCGGGCTAAGTACCACCGGGTACG
TCCGCATGGCGGGCACGGACTTCTGCTGGGCTTGCAGCCGCAGCACTCCGCGACAATTGTGATATCGGGAAATGACCGAGAACAGCCCGCGCCGAGGCCT
AACGGTCTTGAACCTTCGAGTGACAACCAGCCGAGCACTCTGATTGGTTACTCTCCTTCCCCGCACTAGAGTGACAGTTGGACAGCCATTTAGTGACCAG
GCACAGCGGGTCATAATAGATCCCCGGTGAGCCCTCCAATTAGTCATAGTGGGTACAAGATTTGCCTCTCATTATGAATCCGGTCCTAGCCGAGGAGTCG
TCGAGTCGTCGGTCCGGCTCGAAGGCTCGGTTGATACTCGACATTTGTATAGACATTAGGGATTAGTTATAGGGAAGGCCTCACAGCCTCTAATCACTAA
ATCAGAGCAGAATTCCCCCCCGAAGCCACACAAGGATCAAGTCCGTCTACCGGTAAGTCTTAGCTTAGCTGTAGAGTCTGGATACGCTCGGCCGACGCGG
GGTATGCCTGCCGGTGAGCATAAGGTACATTGGCCGAGTGTTCATCCCTGGAAAGGCCAAGAGTGAGTAGTGGCCGAGTGTTTGAGGTATTAGAG