Description :
From Genome Similarity Track
Location :
Scaffold_10:57140- 60722
Transcript NameFunction/comments
Sapdi_VS20SDRG_04016hypothetical protein

Sequence
3582 bases(100 bases per row)
GCTGCACCGCCAGCCAGCGACTTCCGCCACGTGCTTCTGAACCCGCGCGGTGCTGAGGCCCCAGGGCTATTCTGCTCGAACGTCGTCATCACGTCCAAGT
ACACGGCATGGTCCTTCCTGCCCAAGTTCCTCTATGAAAGCTTCAAGAAGCTCGCCAACGCCTACTTCCTCGTCGTGTCCGTGCTGCAGTGCGTGCCCGC
AATCTCCAACACTGCGAAGTACGTATCCTATGCCCATAAACAAGATAGCTCATACGTGCGGTAGTCTGCCGTCGTCGCTGCCCGTGCTCTTGTTCATCCT
CGCCGTAATTTGCTCGCATCTAAAGCCTCCGATTTAAACGTCAACGTGCTAGGTGGATGGTGTACTTGCGATCATCGAAGACCGTCGGCGCCACCTTGCT
GACGAAGAAGCCAACTCGGCCAAATGTCAAGTCGTGACGGCGAGTGGCAGCCTCGAGACTATTTTGTGGGCCAACCTTACGGTTGGCTCAATCGTCAAGC
TGGGAAACCGCGACACGGCGCCGGCGGATCTCTTGATTCTCGCTGTCCACGAAAATGACCCCGACAACAAGGGTGGCATCTGCTATGTCGAGACCAAGTC
GCTCGACGGCGAGACGAACCTTAAGCTCCGACAGGCGCTCGAAACGACGCTTGAAGCTCAATCCGAGGCCGAAGTACTTGGACTGCACGGCCATGTTGAG
TGCGAGCAACCGAACAAAGCTATCAGCCGCTTCGCGGGCACGGTCCTTGTCGACGGCATGGAAAAGACGCCCATTTCGATCAAAAACATCCTCTTGCGCG
GCTGCCAGCTCCGCAACACAGAGTGGATGTACGGTCTCGTGCTCAACACTGGCCCGGACACGAAGATCATGCAGAGCGCGTCCAAGCCTGTGGCAAAGTG
GAGCTCGATCAACGACCAAGTCAACGTCATGATCCAGTGGCTGCTGCTCATGCTCCTCCTCGTCTGCGCCATTGCTGCGTCGACGCAATACGCCTGGGTA
CCTTCCACTGCGAAGCGGTTTCTTGACGCTAAATGCTGTGCGCAGGAGCAATCGTTCAACCAATATGCGTGCCACGCCGAAGACAACTCGTGCTACCTCA
CCAAGAACGAATACACGGGCTTCAGTCGCTGGTAATTGCGTCACTGCAGGCGTTCGTAACGCTCGCTTTAGGATCGTGGCGTGCGGCAGCTACTTCCTCC
TCATGTACCAGATGATTCCCGTCTCGCTTTACGTGACCATCTCGACCGTCATGTTTCTGCAAGCGATCTTTATGGCGTGGGACATGGACGTCTACTATGC
AGCTCTCGGTGCGTTGCAGAAAGGCTCTGGATACACCTCTGAATCGTTCTTCCAGACGTGCGCATGATTGTGCGAACTATGGGCCTTAACGAAGAGCTCG
GCCAGATCTCATACATTTTCTCGGACAAGACGGGCACGCTCACGTGCAACGTCATGGAGTTTCGCAAGTGCTCGATCAACGGCGTCTCGTACGGTCTTGG
CACGACCGAGATTGGTGCGTCAATATTGGAATGGATTCGTCGATGACGATATATGTCAGGTCGTGCTGCCCTCAAGCGCAAAGGCGTTCCGGTCGCGGAG
CCGTCGTCTGTCGTCAAGCCCGGAACTCAGATTCCGTACGTCAATTTTGAAGATCCGCGCCTCCACAACAAGCTCAACGTACAACTGTGCATGCATGTAT
ATGATCTCAGACTCGAGATAGACGATCCCGCTCAACGACAACGTCGAGTTATCCAAGGAGGCCGACTTTTTTCTGCACCTGGCGATTTGCCACACGGTGA
TCCCGGAGGAGTTTACGGACAAGCATGGCGAAGTCGGTCTTCGGTTCGATACTCCTACGCTCTCTCAATGTCCTCACTCGGTGCACCGTAATAGATACTC
TGCTTCGTCGCCCGATGAGCAAGCGCTCGTCTCGGCGGCCAAGTTTTTTGGCTTTTCCTTCGAGTCTCGGGGGCTGGGCGTCGCCCGCATTCGCATTACA
AACAAGGCACTGCTCCACGCCAAGGGCGAGAGCGAGCTCTGGGAGTACCAAGTCTGCGACGTGCTCGAGTTCAATAGTGAACGCAAGCGTATGAGCTGCG
TCGTGAAGGACCCGCAAGGCGAGTATCTGCTCTTGACCAAGGGCGCCGACAATGTCATCGCGCCGCTCCTCTCGTCGAGCCTGAATGATCCAGACATGAT
CGCAGCCACCTTTAGCCAGCTCGAAGCGTTTGCCGACGACGGTCTCCGGACGCTCACGATTGCAAAGAAGACAATTAGTCGCGAAGAGTACATGCAGTGG
TCGCAACGCTACCGCGTACGTACTGCGTCCATTCTCTTGTGATTTCGTCAACGCAATGGTAGGCGGCGTGCGCATCACTCGAAGAGATTGAAAAGCGGAA
GCGCGGTGACGCCAACGAGATCGACCGGCTCATGACGGCGATCGAGCAAGACCTCGTGCTTCTCGGTGCGACCGCAATTGAAGACAAGCTCCAGGATAAC
GTGCCCCGTGCGATCTCGCGCCTCATGGAGGCCGGCATGAAAGTGTGGGTGCTCACGGGTGACAAGCAAGAGACTGCCATCAACATCGCGTATGCGTGCC
AGCTCATGGACAACGACATGGAACAGTACATCTTCAACATGGACGAGTACCCAGACTTGGATGCGGTCGCGGTGCACCTGCGCGAGTGCTGGACGGCTGT
CGAGACGAATCCTGGTGTCCGGCGGTCGCTCGTCATTGATGGCGACGCACTCGAGCTCGTCATGCAGGATATTGACACTTGCGCGGTGTTTCTCAAGGTG
GCCATGCGTTGCGACAGCGTTGTCTGCTGCCGCGTGTCCCCGTCGCAAAAGGCTGAAGTCGTCGCCCTCGTCCGCAACAACAACCTCAAAGCGCGGTATC
TATTTTTTCTCACCTGGTTCGCCAAGCTCACATGCTTGGTTTAGGACGCTCGCGATTGGCGACGGCGCCAACGACGTGGCCATGATCCAGCGCGCACACA
TTGGCGTTGGCATCTGCGGCCAGGAAGGCATGCAAGCCGTCAACTCGAGTGACTATGCGATCGGACAATTTTACTTTTTGGAAAAACTCCTGCTCCACCA
CGGCCGCCTCAACTACATTCGCATGTCCAAGCTCGTGGGCTACATGTTTTACAAAAATATTGTCATGGTTCTCGCGCAGTACTACTACCTCTTTGCGACT
GGTACCACTTTTGCCAACGGACTCGGTGCTCACTTCAAATAGGCTCGTCCGGCCAGAAGGCCTACTCGGAGGTCGCGTTCCAGTTGTATAACCTGTGCTT
CACGTCGCTTCCGATCATCGTGCTTGGCGTCTTCGATTACGACGTGCCGTGGAGCGTCGGCGCGCAGTTTCCGGCCTTGTACCGCGTGGGCCTCAACGGC
GAGCTTTTCAACACGCGCGTCTTCTTCCAGTGGATCTGCGCCGCTGTTTTCGAGTCGGCCGTCATTTTTGTCTTTGCCATCTACGGCTACAACCAGCTCG
AGCACGGTATCGGCGCCGCCAACATCCAGCAATACGGCATCCTTATCTTTGCCCTCGTCGTCTTTGTTTGCAACCTCAAGGT