Description :
From Genome Similarity Track
Location :
Scaffold_46:57126- 61840
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012952Similar to CALML3: Calmodulin-like protein 3 (Homo sapiens)
Pytul_DAOMBR144PYU1_G012951Similar to cat: Catalase (Rana rugosa)

Sequence
4714 bases(100 bases per row)
AACACTGCAGAGGCGCGGTGACGCTGCTACAGGAGGAACTCCAAGCGCGGCAATGCGAGTTCCATCCAGTTCTCCGTTGCTGCCTGCGTGTATACATACC
TCTCTTCTGTTTGTTGCCATGGTTACCATAGATGCTGCTAAGCTTTTCAACATTGTAGGTGCAGGCTTAACGTTGAGGAAGTCTTGCGTTGAAGAGGATG
GGAGTAGGCATTATGTACTCACCTGGCCAATTCCAGTTTTGACAGGCGCTTCCTGGTACTAGGTCCAGTCACTTGGAAGATGCATGGGTTCACTTTGGAG
CATGTATCAGGCAGGCTCTTGCCATTCACACACATACCGTGGGCGGGCAAGATCGCAATCAGCCTCATAACTCCACTCAGACTCCGTCCAAAGATCGTTC
AACTCGAATACCATAAATATTCAATTATAACGCCAGTGTCGAAGTATACTCCTTTCGGCTGTGGCACATCGGATGAGAACGCTCAAAGGAGAAAAGATCA
ATGCAACTTGCCTGAACCAACTGCTCAGTGTACTGGAGAGACAAGATTTGTCGCACCAACTGGAAGCATGGGCGACGGCGCGTCTGTATTTCGATGGAGG
TGCACGCAGCAATCCAGGTCCAGGAGGCAGCGGATGGGCACTCACCTTCCTGAATGAACGCTACAATCGATGGGAACTCAAAGCATGCGGCTATGCGTAC
ATGGGACCAGAAGTTACGAACAATTGGTGCGAATACAGCGCACTGAAAGAAGGCCTGGCATACAGTGCACACTACCTAAAGCATTATGAAGTCAAGTTGG
AAGTCTTCGGAGATAGCCAAATGATTATCGCAGCCCAGAACGGGTTTTCCTCAATACGCCAGACCAAGTTGCAGCCACTAGCAGTTCGGGTAAATCAAAT
CATCGACAACTTTGCGTGGGTCTCCTGGAATCACACAAAACGAGAACAAAACAAAATGGTGGATCTTCTCGCCAACATGGCAATGAACTCCCAGAGTGCG
AAGATACTCACCGACGAATCGCGGGGAAATGATCGAGTTCTTATGTCCCAAGTCGCAGATCTACTCGAAAATGACGTCGGTGCCACACCATCAAAACTTA
GAAACACCTCACTCTCAGCAGTGTTAATGAGACTCCGGAATTCTTAAACTATATGTAGATCATAAGTTAAATAGAATGACCTTCTCTCTCGAAGTATACT
CCTTTCAGCACAAAAATTCTTGGTAAGAAACTGATGCTGTTTGATTAGTTTTGTCTCACTATTTATGACTGCAGCATCTTGCGAAAGTCTGAGACGTTGA
TGTGGCCGTCGCCGTCGGCGTCAGCGCACGAGATCAGGATGCCCAGGTCTTCCTCTGTGAGCGCACCGTACCCGAGTCGCTCAAAGACGTACTGCAGCAT
CTCGCGCGAGATGAACCCCGTCTCTTCCGGGTCGTACGCCTTGAACGCCTCGGCCACCGGGTCAAAGTTCTTGACGTCGTTCGTGAGCAGCAGCGTGTTT
AGGTACTCCTCCGTGAGCTCCGTCTCGTCGTTGAGCAGCAGCTTGGCGTCCTTGATGCTCACACTGTCGTAGAAGATACTCAGGCGCGCGCGCAGGTTAT
CGAGCGTCACACGCTGCTTCTTGTCGATGTCAAGGAACTGGAACGCCGCGTGGATCTGCTCCGGGGTCACGAGCACACCACCGAATTCCTGTGTAGACGC
AAAGCACAAAGAGAGATCAGCATTATGGCAGCAATTGCAACGAGCAGAGACAGAATGTGAGAAAGAACGCACGTTTTGAGGCACTTGGTCGACGGGCAGG
TCGTCGCCCTCGACCCGGTCACTGGCAGCAACCACGGTGACTTCAAAGCCGTGGCGTCGAGGCTCTGCGGGGCTCCTGGGGACGGCGACACTGGTGCGTG
CGTTCATAATTTACTTAGAGACTCAACAACTTGGTCAACGGCAATCTTTGATTTGCTCGGGAGAATGAAAGCCACAGGATTGAAGACAGCACAGCAACGT
GTCAAGCCTAGGCAGGTTTCTTTGAAATGAATTCCCAAGCGGTGGTTTCATCCAAAGTGAGAATGGAAATAGCTTCAAGGCCATCAAAGCTGACTTGTGC
TGTACGTATATATTACGTAGGAAATGACAGTCACGTGTGGTTCCTAAACCCGAAAGCTTACAAGCTCAGCATACAGCTACCAAAAGATGCAATTAGACCA
ACACTTTAGCTTTACGGGGTGGCGGCAGTGTACTTCTGACGCGGCGGGTTCAATGGGGCGGCCGTCGCCTTCTTGGCCGCTGTCGCAGCCGCCGCGGCCT
TGACAAGCGCGTCCACTTTTTCCTGCACACGCTGGCCGTAGTGCGAATCAATTTTCAGGAAATTGGTGATCGCGCGGTCCTGGACGGGCTTCGAAGCCTT
GGATAGCGTGCCCGCGATGTTGGACGTAAGTCGCTCGCGCGCGTCGGCGTCCAGCGTCTTGCGGTAGAAATCACCGACCTGGCTGAAGTTGTCGTCGTCC
ATGGTGCTGTACTTGGTCACGACGGTGTGGTTGCCTGAGTACGTGTAGAAGGCGTGCTGGGTGGATTCCTGGGGTGCGGCTGGGTCGATGCTGTTTGGGA
ACCAGTTGGACAGACTACCCATGTTGCCGTTCACGGTCGCAAAGCCGTCGCGCTGGTACGTGCGCACGGCACTCAGTGGTTTGTTAACCGGAATCTGCTG
GTAGTTGACGCCGAGACGGTATCGTTGCGTGTCCGGGTACGAGAACAAGCGACCTTGGAGCATCTTGTCGGGCGACGTCTCAATGCCTGGCACGAGGTGT
GACGGCGAGAACGCGATCTGCTCGACCTCGGCAAAGTAGTTTTCCGGGTTCCGGTTCAGTACGAGGCGTCCGACCTCGATCAGCGGGTAGTCATGCTGAG
ACCAGACCTTGGTCACATCGAACGGGTTGAACTCGCACTCGTTGGCTTGTTCTGGTGTCATAACCTGGATGTACGCCGTCCAGGTTGGGAACTCCTTGTT
GGCGATGGCGTTGTACAAGTCCCGTGTGGCGTAGTCCGGGTCCGAGGCCGCGAGCTTCTCAGCTTCGTCGACTGGCAAGTTGCGGATGCCTTGATCCGTC
TTGAAATGATACTTGACGTACGTGACCTCGTCTTGTGCGTTCACGTTCGTGAACGTGTGGCTGCCGTAGCCGTTCATGAAGCGGTAGCCGTCAGGAATGC
CACGGTCCGAGAACAGGAATGACATCTGGTGCGTGGTCTCAGGGCGTAGCGAGAAGAAGTCCCACATCATGTCGTCATCCTTCAAGTGCGTGGCTGGGTG
ACGCTTCTGCGTGTGGATGAAACTCGGGAACAGGATCGGGTCGCGAATGAAAAAGATCGGGGTGTTGTTGCCCACGAGGTCCCAGTTGCCTTCCTCCGTG
TAGAACTTGACGGCAAAGCCTCGTGGGTCACGCACGGTGTCAGCAGAGCCAGATTCACCGCCGACAGTCGAGAAGCGGATGCCGATCGGGGTGCGTTTGC
CGACTTGGTCGAACAACTTGGCCTTGCAGTACTTGGTGATGTCGCTGTGCGTCACCTCAAAGTACCCGAAAGCACCAGCACCCTTGGCGTGCACGACTCG
CTCGGGGATGCGTTCGCGGTCAAAGTGCGCCAAGTGGTCGATCAGCGCGAAGTCGTGGAGCACGATGGGGCCACGTGGACCCGCTGTGGTGGACGCCGTG
AGCGCGTTTGGTGGCAAAGGCGCGCCGTTACTGGCGGTCGCGAAATTGGTCATCGTAGCTTGAGTCTGGGTTGTGGTAGATGGCACTTGCTGTGTAGAAA
GCAAATGGAAGAATGAAGCCAACGCGGTAGCGCTTCTTGAGATTCGGTACATGAGATTTTCACCAAAGCGCACCCCTTGTAGTTCCGGAGGTACGACAAG
GGATGGAATGGGACCTTGAAGCTCTGAACGCTGAAAGAAGAGGGCGAATCGGCGTGAAGATGCCTGGGCAGGTCTCACTTCCATACTTCCTTTCTCTCTC
TCTCTTTTGAGCTCACTATGTCAGCCGTGCTCTGGATGCGGTAAGCATTGCGTAGAATGAGCTGCGTGTGGTTACTTTCGGTAGTCTCATCCTCGTAAAC
ATCCCTAGACCACCCTCGTCGTACCTGTACGTCACTCACACACAGAGAGAACTGGAAGAGCAACTGTAATAAGAGACAAGGATCCATCTCCCTTTTCGCC
ACATGCGCTGCTCACTCTTGCGTCAAAGGCCATTAGGTCGGACGTTGTCGTACCCGCTGGGAAAAGCTCCGTTAAAAGATACAAGAAGATTGAAAATGAT
AATCTGATGCGCATCAGCTAAGTGCGCGTCAGAGGTGTCTGAATCGACAATACGCGAACTTAATGAATATCGTCGAGATTTCATTGGAGAGATCCGCTTG
ATACGAAATACGTACTTAGTGAAAGGTTCGCTGGTTGCCCTCCTTGTCACACCTGGCATGCGAAATGGCTACATTCTGACAAGGTAATGAACGGACGACA
CAGAAGCTTTTTTATTTGACGAATGATGGCTTGGAAGCTATCGCACAGTGTACAAACTCGTATATGCTCTATTTGATACGCCTGCTGCCTTTGGGGGAAG
GACATAGGGAAATAATCAGTTTTTCCACTGGGTTCTTTCATATGCCATCATTGTCTCAGTGTCGTAGACAGCATGCTTACTGACTGGTATGCCATTCAGA
ATGTCCGCCCTTGG