Description :
From Genome Similarity Track
Location :
Scaffold_19:57109- 58721
Transcript NameFunction/comments
Physo_536507Hypothetical protein
Physo_536381conserved unknown protein

Sequence
1612 bases(100 bases per row)
CGAAACACGTCCGTTTGACTTTCCACAAAATCGGAGCGGCAGCGCCTGGGCCTCCCAATACGAGCATCTCCTGGTGCGGATCTACCCCATTGACCTCAAG
TCGGTTGTAGAATCTGCTCCTTCGGTTGATAAAAGTCCGAAGGCAGCTTGTTAGCTTCTTGTCGAGATCGCCAATTGTATCGCGATCCAACCCGTCGATT
TGGGTGCACCACCTATCCACACGGCTCTCCTTCACCAGGCTGCGCTCTGTCATCAACTGCAATATCGAGTTGCAGTCGTCAATGCTCAGCCCTGCTCACA
GAGGCAATAGCACAAGACAGTGGTCATACATTTACTTTCAAGCACGCAATCTGGGTGTTCCCGCCAACGCACCCGAGTGCACTGCGCCTTTGGTGCCCGT
CTTGTGCATGCACGGATGCTTGAACCTCTGCGTCGTTCGGTGTCGGATCTCCCCACGGCGGATCTGCACGCCTAGATCCACGATACGGAGATACTGCAGC
CATGCAACACCCAATCAGTAAGGCCAGAGTCTCTAGACCCCTTGTTCCTAGCTACTGGACGCACCATCTCGAACCACTTGGCAGCCGACTGCGGCGACAG
ATTCGCCAGCGTGTTCGTCTCCAGCTTGTCGATGGCATCCCTATAGATTTCCCGCAGCCGGTCGATCTCCGCGAACGCCGCCGTCAGGTGCTTCGACAAG
CGCTGGCCCTCGCCCCGCATCGCCCAAAACAAAAACTAGAGACTAGAGACTAGAGACCGTAACACTAACGCCAGCCAATGAAAATTCACTTTACAACTTG
AAGTCTTGTCCTAATTTGCGTCATCCGTCATGGTCAAGATGGTCGATCGCTGCTGCTCCGGCGTTGCCGCTGCCGCGCTTCCGCTGCGCCAGTTTGGTCC
TGCTCGAGGCCTTGATGACCTCCCGTGTCAGCACCTCCGTCTCCACGCCTGGCTCCTGCTCGCCGTCCTCCGGTCCCAGTGAGCCATTCGTGGGCAGCTG
CGCCAGCGACTGCGTGGCGAGGACGGCGCTGATGGCGACGGCCAGAGGCGGCACGGCGCCGCGGTCGAAGCCCACGCGGTCCTTCTCCTTGTCTTTGTCT
TTGGCCTTCTCCACGACGCTGCTGAGCTGCTGCGTCCGTCGGTAGCGACTCGAGCGCGCCGTCGCCTTCTCGTCCCCTCCGCGTGTCGCCCGACGTCGGG
TTCGAGACGGCGAGTCTGCAATCTGCGGGGATAACAATCCAGGGTCAGCCAAGACAAGTTTCAGGACAAGACTTAAAGAGGAGAAGAACCAGTCGTACCA
GGGAGAAATTAATGTCCGGGTCGCTCCTAGCCCCCTCAGTCTACAGAGAACAGGGACAAAGTACCAGAAAAGTTAGCGCCAGAGTCGCAAGAGTGGGCAA
GAACAAGCAAGATGCAGCCAGCAACAATGAATGGACGTACTGCATCGATCATGAGTGTCGCTCGGTCTTGGCACAGCTGCAGTAGCGCTGTGATTGCCGG
TGGCTCGAGGGTTTCGAACTCGGACGTGAGGCTGTTTTCCCCTTCGTAGCCCACGGGCGGTGGCCAGAGACGAGCAGCAGGGATGGCGTTTTGGTACGGG
TCCGAGCAGTTG