Description :
From Genome Similarity Track
Location :
Scaffold_762:571- 2359
Sequence
1788 bases(100 bases per row)
CCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTC
GTCTACCAAACTGGGCTCGTCATATCCACGCCAATACACCAGAAATTCGCGGTAAATCCGTCCGTACCTAGTTCGCTTCCCTGACCTCATGTCGGTGATC
TTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACCTTCAAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTTGGACTCATCCACCGAAA
GACGGATTTGCGACCGGTCCGGATATTCCTTGACCAGCTTCAGCTTGGATACGTGTACCACGGGGAACAAGCGATATTCGGTACCTGCTGTCTCCAGCTT
CACAGCGTGTTCCCCTATCTTCTCACTTACTCGGAACGGTCCGTGCCATAGATGGGCCAGTTTGCGGGCATATCCTTCCTTTACCCGATCCAAATACAGC
CACACCTGTGATCTAACTTGGATTTGATGGGGACGAGCGTCTTTGTTGTGTCGATCCGCTCGATCCTGTATCGCAATTCGTAGTCGTTCGTTCACTTGGG
ATCTTGCTTGCGGTAATATTTCTGGACTTGGTATCGCCATCGTCTGGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGACCACTTCTAGGGTA
GATTTAGGATCCCACCCATGTACCAAGTAAAATGGAGTATCGCCCCGGATCCTGTCCTGGGGGGGGGGGGGCGGGGTTATTGCGAAGGTGAGTCGTTCTG
CGTACTCATCCCAATCCCTCTGATCCAAGTTCTGAACATACATCTTGAGCGCCCTCGTGATCGTCTGTACCATGCGTTCGGCCGATCCATTGGCTGGGGG
ACGATATGCCATAGTCGCCCGCTGTCTCTGCCCCCGGATCCGGTTGAAGGCTCGAAAGAAATTAGGCATAAAGCCTGGCTCCCGATCATGCCGAATCATC
TCACTAGCTCCGAATCTCCGAAAAACGCACTTCTCGTACGATTCGGCGATGGTTTTGTGCAGCTCTGGACGCGCTAGCTTTTGGCTATCACGTATTCGGT
AAATAGATCCGCCCAGATCAACAATTCTGTGTTTTCCGTTGAATGACTTGGGTAGCGAGGGGATGCGATTCCACGGCTTTGATTTGGAATAGGTAAGTCG
CTTGGACGTTCTCTGGAGACCTCCCCCTCTACGAGTGTGGGCCTACCGTTGGCCTGTCTCACATTCACGCATTCATCGACATATCGTTGTACACTCTTGA
AGAGTTATCTTCAGTGAAACATTCTTGCATCCGCGGTAGGTCCGACCGATTCCCTGATGTCCGCCTTCTATGCTAGCATGATAGTGATGTAGGACATCCT
CTTGCAAGGTTTCCGGCATCACCAATCTCATTAATCCGTCTCGATCCTCGCTGACGCTTTTCGTGGGGGGACAATAGAAGAGCAAATCATTCAGATCTAC
TGCATAATCCGTAGCGATAATACTGTAGGATTTAGCATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCT
TCTTCGTTCTGTGCTATGAGGATCCGCTCAATACGGACTCCCTTCACAAATGCTTCATCGAGAATCTGGGGGCTAGATCCAATCCTTCCTCTGGACCTAG
TGACGGCCATCACCTGGACTGTTCTTTTCTTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGACGCTC