Description :
From Genome Similarity Track
Location :
Scaffold_14:570948- 574142
Sequence
3194 bases(100 bases per row)
CACCGTGTCTCCGCTGGTAATCGAAGTCGTTTCGGCGCCGTCGTAGCGTGTCGGGTTTCCAATTCACTGGTCACTGGCTCGATGTCGCCGGTGGGTTCTT
GTTATCATTCTTGCACTGACAAGATGTGTCAGTGTTCGCCGCGGCTCACGCCGACGTTGCACGCGTCGGAGCGCGGCGTCGTTGTCGCCTCCTCGTGCGG
GTCGTTCTCGTGGCCGTTCTCGATCTCGCTCACGGTCGACCCGCGGAATTCTTTATCTCAAGCTGCATTGTCTCATACTCGTGGACCACGTCCGGACCGT
CGCGGAGAAGATTGGCGCGGGGCTCCCACGTATCATGCTCTGGGGGATAACCGAGCCAACGTACCAAATAGCGGCGCGCGGTTGGAACCGCGCGAGGGAC
ACGACTACGGGCGTTACGTTGGTCGGTCGAGCTGTGGGGATCCTCGTGGTCAACTATACGCTCCACAATCCAGCGCGCATCACCCATCGAATCAATTATC
GGTGGTGGGCCTTCACGATGATACGGCGTACACCCTGTACGCTCAGGGCGAGGTGGAGACAGCTTCAAACCGTTCGTTGGACACTCAGATTGGAGCTGAG
CGGGCGGTATAGTGCCTGACAGACGCGTCGGGTTCGTCGGGCTGGTCGCCCGACGCATGCTCCGTCTGCTGGCTCGGGTCAGGAATCGTCGCAGGGAAGT
ACCGCTTCAGACGCTTGACGTAAAAAGTCGGGTGAAGTCTAAGTGACGACGGGATGCCCAGGGTGTAGGCGTCGCCCACAGACTTGGTTACTCGAAAAGA
ACCGATGAAGCGTGGAGCAAGTTTGTTGGCGCCGAGGTTGCTTACGGCAGAAGCTCGGATTCCCTCGGTCGATAGGAGAACGCGATCTTCTGTCTTGAAT
ACATTCACGTTCTTTCGACCGTGCTTATCAGCTTGTTCCTTTTTCTTGTCCACTGCATTCTGCAGTGTGTCGCGGACGAACCTTGAGATGGATTGCCTTT
GCATGACGAATTCCGCAACTGCCGAGCGATCGGCAGGAAGCACCGAGGGTTTCGGTGTATAATTGGACGTGGTAACTGCCTGCTCGCAAATGTTGCTGCC
TGGATCGATCAAGTTCTGCGACGTCCATCTCGTTATCGGAGATGCAGTACGCCGAGGAGGCTCGATGGACTGCTTGGACGGAGAGCGAGTCAAGGCGTTC
ACACTGGCTACACCCGAAGATAACCCTGAAGTTGAGTGCGCCGTCAGGCCTGTTGGCACCGGTGAGGCTACAGGTGCGTGCTGAGACACCGGTTCACGTA
CCGGTGATGACCACGACACGGACTCATTGTCCGCAGGACTGACCGCAACTTCAGCATCCGTGTCTACCGAAGGAGATCCTCCCCCACCAAGGGTGGAGCC
GCCAGCATCCGTAGGGTGGCCCACGGCAAGAAGTACCGGAACACGTGGGTGTCGAGCGTTGTTCACGAAGAACGGCGTCATGCCCGTCGAGAAGTGCTCG
GCGTTGTTGAGTGCGAACTCGGCTAGCGGTAGGAACGAGCTCCAGATCGTGTATTAAGTCGCGTAGCTGCGGAGAACGTCTTTAAGGACTCGGTTGACGC
GTTCTGTTTGTCCAACCGTCTCCGGATGGGCCGCAGTCGACATAAACAATTTTGTTCCCAAGAGCTCGAAGAGGCGTGACCAGAACGCGGATGTAAACTG
CGGGCCGCGGTCGGACACGATGGACTTCGGCAGACCGTGGTGACGAAAAATCATGTCGACGAAGTGGGCCGCGGACCCTATCGCGGTGATTGAACTACCA
CCGGAACGAGATGGACCATCTTGCGGAAACGATCGACGAACACAAGTACACCCGTGCGCCCGGCTGTATCGGGCGGAAGACCGAAGATGAAGACCATCGA
AATGGAGCGCCAGGCTTCCGTCGAAGACGGTTTGACTCGCTGGCAAGTTTCACATGTGCGGACCCACTTGGGTACCCACTTGTACATGTGCAGCCAATAG
AAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGATCGAGATGTCCTGTAGTCGGGGCATCATTATACTCGTGGATTATGCGCGCACGTAGATCAGCGT
CGTTTGGGACGACGACTCGAGGTCCATCGAACCTGTCGATGCTGTACTTGAGCAGATTGCCGTCCAGTCGATATCGATCGATCTGATTCAGCGTGGTCGT
TGACAGGGTACTAAGCGTGTCACTACTAGGAGCACGCAGGTGCTTCATGATGGCACCGTATATAGGGTCATCATCGTACGCTGTAGCAATCTTGTCGCCC
AGCGGGAGCGTGGGCGTGGTCAACGTCAAGTTCATGCCTGACGACACGCAGACCGCACATTCGTCGTCGTCCTCATCAGCCAGCTGATGTCCTAGCGCTT
CATGGGGATAGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATGTTATTCTTGCCCGGCTTGTAGTGAACAACGAAGCTGTACTCGGAGAAGAAGGA
CAGCCAACGGGCCATCCGTTGCGACAAGTGAGGGCTCTCCATCGCTGTCCGCAGCGATGCGTGATCAGTGTAAACCACAAACGACTGTTCACCGAGCAAG
TACACTCTGAATTTGATCAGAGCGTTTCGCATTGCCAGGAGCTCTTTGTCGAGGACTGGGTAATTCTTCTCGGCTGGCTTCAGTTGGCGCGACTGATAGC
TGATAACGCGTTCGTGTTCGTCATCATCGAACTGCATCAGCGCATAGCCGATGGTAAAATCGCTCGCGTCGCAGACGACGTGGAATGGCTTTGAGTCATC
AGCAAGCTTCAGGATCGACGCAAACGCCAAGCACTTCTTCACCGAGTCGAATGCAGCTTGGTGGTCCGATTTCCACTCCCAGATCACGTCTTTCTTCAGT
AGCGAGGACAGCGGCTGGATCAATTCAGCGTAATTCTTCGTGTATTTGTGCAAGTAATTGGCCATGCCAAGCCACTGACACAACTCAGTGGGGCTTGTCG
GCGTTGGCCAAGCACAGATAGACGATACCTTCTCCGGATCCGCGCGCATGCCGTTCTTGCGCACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAGAA
GACACATTTTTTCAGGTTTGCGTGGAGCTTGCTCTCTCGCATCACCCGGAAGACTTGCCTCAGGTGTTTCAGATGTACTTCCACGGCACCGAGG