Description :
From Genome Similarity Track
Location :
Scaffold_1:5709090- 5725670
Transcript NameFunction/comments
Physo_472219similar to CHY zinc finger domain-containing protein
Physo_345422Hypothetical protein
Physo_553606endomembrane protein 70-like protein, putative
Physo_345424Hypothetical protein
Physo_248383Dihydropteridine reductase, putative
Physo_471055ferric reductase, putative

Sequence
16580 bases(100 bases per row)
TGTTCCCAGCCAAGTCGAAGACGACCTAGTGGTATTCTTACATGATCGCTCTACTGTTGCGCGTTGGCATTCCCGTTGGCGTTCTCTCTTCGCTTCTTGG
CTTCGGCGCCAACGCGCTTAAACTTCTTGCTCTCCGTTTTGGTTTGGCCACGATACTTATGTTTATCCCAGCGTGACATTTGCAAGGAGTCACGGCAACC
AGTCCCGCCTTCCCAATGGCGAGAGGCTGTCTTCTTCGCTGCAACATCATTGCCACAGGAGCACACTTTCACTGAGCTCGACTGTTCTTTCGAGCATAAC
CCGCATATCATCCGGCTTGCAAACTTCCCCAGGTTGGCTTCGGGGCAGTCGCTCGAATCGTGGCATACGTCGCACGGGAACGCTTTGCCGCAGCATTGGA
ACCGAAACCATCGCAACGAATGCTTGTAGTGATCGCACGCTCCATTACGCGGAAGCGGCTGGCCCAGCACGAACGTTTCCGTCGGTTCCTTGGCTCCTTT
CTTGCTGCCCCTCGCCGCCTTGACTGCGGAACGATCGGGTGAGTTGCTTCGCCTACTGCTTAATCCTTCTAGCTGGCCTGCCACGAAGCGCTTTGCCATA
ACAGCGAGCTTGATGTGGCAAGAAAAGCAGGCTTGTTCAGACCGCTGCCTCGGCGCAACTCTCTCCAGCAATGCTTCGCATCCGCAATCTAGGCAAGTGG
CCAGCATGTCGGATGGGAGCACATCAACAATGGAGCAGTTCTCGGTATCCACGTAGGCAAGCACATTGCTCTGCGAGTGAGCGAATACGGGCCTCATGAG
AATGTGGTGGAGCACGCTGCATCGAGGGCACCACTTCTGGATCGCTGGGGAGTCCAAGCTGAGGGTAGTGTCAAACTTGAGGGGGCAGTTGTCGCACTCA
ATCTGGCAAACAAGTCGATGGGCGACAAGCGTTCCAACCTCATGCAGAAACAGATCGTCGAGGCAAATTTGAGTACCCTTGACGTCAGGTTCAGTCTCAA
CCGCCACGCGCTTCTCTGGGGGAGTGATCTTCAAGTTTTGGACATACCCTTCGTTTTTGTCTGCATCAGTTGCGTTCTTCTCTTCTTGCACCTGTTCTTG
CTTTTGTTCAATCTTTGCTGCGGCAGCAGTAGTGGGATCCACACCACGCTTGACGAGCTCGCATAGCATCTTAAACCGGTCAATACACTCATTCAGAGAG
CGGCCTTCCACTTCGCTGGCTATACTCGTCCAGCGCTCCTTCTTGTCCATTGACGCCGGGTATTTCTTCAGGGCCAGATCAAGTGCACGCTGTTGTGCTT
CGGACCACTCGCTGCTATCGTCGCCTTTAGGAACGACATGTTCAACACTGGATTCCTCAGTTGCGGTGACCTCTGCCGTCGTATCCGATACAATCTCCAA
TGCTGCTACCGCAGTTTTAGTTGGAACACCCAACTGCGCCACAACAGCACGCCGCGGGGGATCGGATTCCTTTTTAGCACCCTTGACATCATGTGAGAAC
TTGCATTTGTCTCCATCACGGCACTTGTGCTGTGCGAAAAACTTGCATTTTCGGACACGGGTTTTCATTTTCTTCTTCCGTTCCGCAGCTGGTGTTGCTG
TGTCCGACGATTCAGGCGGTTGGGCTGGGTCGGCTTCCCTAACAACCGAGGTGTCATGCGCATCTGGTGCATCCAACGCTTCGTCACCACCCCCTTTCTT
CAGCTTTTCTTGCTTCTTCACGTGCGAGAACTTGCAGTTTTCGCCGTCTCGGCAGGTGCCTCTGGCGAAGAAGCGGCACGGTCGTTGGCCGCGTCGCCTT
TTTGGTTTCTTCTCAACCGTGGTCGGGGTCTCCTCGTCAGCGGCAAGTGTCGCCAGTGCATCGCCATCAGTGTTCGTATCTGCTGGAGATGCTCGCTCCT
TTTCCTCTTTGATCTCGAATGGTTCAATAATCCTCCAGAAGTTGTTATCCACCCACGTCAGCAGCTTCCGCAGCGAGAAACCTCCGCACAGTTGTCTCGC
GCGAGCGCTCACTGCAGCATTCAGCGCTTCCACCTGCTCGCTCGACAGTCGGCTGCTCCACTGAGCAAAATCCACCCGAGCAACCTCCGCCGGGTACTTT
CCAGGCAGGGTCATCACCAGCTCCACTTGGCCTTTCAGTCGCGCAGGAAGCTCCGGATCCGACAGACTCAAGAAGAGCCGCACGAGCTTGTCTTGCGTAG
CAGCGTCCTCACTCGCCAGCTGCAGGTGGTAGCGGCGCTCCAGCGCCATCCACTCCTTCTTGGCGGCGTCCGTCTCGCTCGCCAGCGCCTCCTGCCAGCT
CGAGTCTGCCATCGTTCTTTGAAAAGGCAAGTTGGAAAATGACAAGAACGTCAAACAACGAAGCTCAGTGATTGGTGGGTTGCTGCGGAGAATTTCGCCG
GAGCGACCGTTCCCAGAATATTCGATCAGGAGCTCACTATCCGAGCAAAAGCCAACGGTGCAATGGCCATGTGGAGCGTGCGTCTGCGCGGGCCTGGCGG
CAAGCAAGTGGTGCTCAAAATCGACCCGGACGCGACCTTCAAGACCTTCTCCGGTTCGTAGTCTCAGTGATCCATCTACTCGCTGCTTGTATCTGACCGC
CAAACGCTTTTGCAGAGCTTACGGCCGAGGAATTGGGTCTGAAAGCTACGGATTCGCCCACCTGTACGTTCCTGCCACTAACTGCACAACGCAGTGATAA
CTCTGATTCGCCCCAATATTTTGCAACGTAATTGCAGTTCGCAGAGGGTTCCCGCCCCGCGCGGTGGAGGCGGACGGCTCTGCGCTCGTCAAGTACGTGT
TCGAGGCCAATGACACTGTGGTGGTCGACACGAACTCGGGTGCGGCAGCTCCGGTGCAGGCTGCTGCACCCACCACCAAGAAAGCTCCTGCGAGACCGAA
GCGAGCTGCGGCAAAGAAACCAGCCGCGAAGGCCCCGAGAGGGGGCGTGCATACGCTTAACCCGCCGGCCACCACCACGAAGAAGAAGGCGCCGCCAAAA
CGGAAAATCACAGGCAACGGGCGCCAACTGGGCAGCTCGCTGGAGAGTAAGCCGCCAGAGGCTGCAGATGGAATTGAAGCTGGTGACGAGGAGCAGGAGC
CACAGCGTAAATACCGCCGCAGTCGCGCGATCAACCTCACTTCCAAGGAGGACGTCGAGATCAGCCTGGTGAATGCCGTGAGCGGTCAATCTAAAGGCCG
GGCAGCGAAGTTCTTCCGTGCGGCGACAAAGAATGCAGTGGAGCATCAATATGAGCTGACACTGGCCACTGCTCGACTAAATGCGGCGCTTTCGCACAAT
TACGAGATTGAAGAGCAATCGACTACCCGGCGCGCTGACGGTAGTGCTGCTAAACTTCGCGTGCGCTTCAAGGAGACGCCACGCAAGTGGAAGGAGGAGA
CAGTTGATCTACTGAAAACTGACGAGCTGCAGGCCATTTTGAAATATGTATTGCTGTCTGGTGGCGAGACCGGGCGTGAAATGCTCAAGCCTTTTAACAT
GGCCCAGGTATCCACGAGGGTCTTCTGGAGTATCGCGCGCTTGTACGATGGAGATGTGGCTGCTGGTTTGGCAGACCTTGTGCCCGATGAAGACTGGTCG
TTTTTGGACACTCGAACAAGGTAAGCTTGCTTATCGCACGAATACTTGGAAATCCGTATTAACGTATTGTGTGATGCGGCGTGATGGGGCTTCCCATAGG
GTGATGTCTGAAAAAGCTATGGAAGCAAAGGTGCGTTTTCGCTCGTTTTTATTCATCACTCTAGCCTGTTACATTGCCTAATGGTAATCTGTGTGCTGTA
CAGGCAAATGAGGAACAGTACAAGCTGTGGAAACAGGGAGGTGCTGGAGGCAGTCGTACATCACCTCGGCGCGCAGAGAGTAAGCCGGAGCCGAAGACAA
CAAAACGCTCTGCCGCCAAGGAGAAGAAACCTGAAGTTATTCACGTGGACTTGAGCGAAGAAGAAGCAGTCGAGCCAAATTATGCTGAGCCAAAACGTGA
ACCAGTAAGCCAGACTCCTGCTCTATCAGCCAAAGAAGCGACCCCCAAAACTCTGCGCACTGCAGCAGCGCAGGCTGCACTAGCTCGGTTCGACCGAAGT
TCGCAGACGAGTGCTGTTGTATCCGCTTTTCTCAAGGATGATAGGCATCCCGCGCAGACTACGGCAATTTCGACCACAGTCGACGGCGTGGAAACGGAGT
CGGAAGAGGAACTCGAAGAAGCCACAACGGTTTACTGTGATACTTGCAAGAAAGCGCGCATTCTTTCGGCAGAAGAAGCCAGTCATGCCGAGCTTGATAA
GGATCCTTGGACTTGCGCCAACTTGGGAAAGACTGGACGAAGTGGTGGATGCGATGCTATCGATGACGAAGTCGCCCAGATCACAGGCGCTCCGATTGCC
CAATGGCTGCAAAAGGCTAGCATTAACACTCGGCAGGAGCTGGCGGACGCCTCCATTGGGTCCACGATGCATGCTTTGGTGAACCCGCTGGACCCCTCCG
CCCCGACAATGCAAGCTAAGCTTGAAAAGCTGATCGATGAGGTGAGTGAACTAATAATGCGTTGACAAGTGACGATTTGGCTAATCGTGTTTATTGTTCC
TAGGCACGTCTCGATGAAGTGAACGACTGGATGTTGGAACTTGTTGGTGATGTCGAAGGGGTGCAGTGTCTCGAGGTTCAGAAGCTTGGCACACCTGCCG
ATCTGATAGCAACCCCCAGCGACTTGATCCTGGAGGCTGCTGGCAAGACTGCCCCTGTTTCTCTCGATACTGTCAGCGTCTGGCAAGCGCGTGCGCAACG
TTTGGTGAACAAGCATCCATGGCTGGCGGAATGGCGCACGCTGTAAGCAAGACATCGGTCTCGAGTGCTGGTAATTGAAAACGAAATGAAGTTTATTTTT
CTTTTCGCCCTCAGGTTTTCTGTCTTCTACACATTGCAGGAGGCAGCAAACAGCACATGCACGGCTCGAATGGGGCTGCCACTCGCCCTCATGGTGACCC
CACCTATCGGCAATCCAGGACAACATCTTCATCTTCGCCGCTTTGGGTCGCCGTCACTTCCTCCTATTTCTTCTTCGCGTCTCACTGCCATCTGATGACT
GGAGCCTTGAAATGCTAACTTGATGACTACTTAGTCGATCTTAATGGAGCTGTAGATCGTGCGAGTGAACCAGAGGCAAGCGAAGTAGCCAATGGTTCCC
GTCAGGAAGAAAAACGTGACCGAGATCAGGAACATGTAACCGAAGTACAGAATGCCCGAAACAAACGCCGTGATGTTCAGCTTCGTGAAGAAGTACAGGA
ACGAGTACAGGAACAGGTACACAGCCGCGGAGCCCGAGGTGAGGAACGAACGCCACCACCAACGGTAGTCCTCTGCGCACAGCTGAAAGTAGCACATCAC
GACAGTCACCTCGGCGCAAGTAGCCACCAAGATCAGCAGCACGATGAACAGGAAGCCGAACACGTAGTAGATCTGGTGCAACCACAGCGCCGACATAATG
AAGAACAGCTCAATGAACACGGCGCCGAAAGGCAGAATGCCGCCCACCAGGATGCTGAAAGGCGAGGAAAGGTACCACACTTGCTCCGGGATCTGACGGG
CAATCTGGTTCGTGCGCACAGGCTGCTCAATTGCAGCGGCCTTGAATCCAAAGTAGCTGCCGAGGAACACGAGTGGCACCGAAATACCGAACCACAGCAC
CAGAAGCGCAAAAAGAGTGCCGAAAGGAACAGCCTGCGACGACGACTTGCCCCACAGCACGAGGTTCAGCAGGAAGAAAACCGCGAACAGCAGACCCGGG
TACAGCACGGCCGTGAGAATCGTGTTCTTCTTCCAGTCCTTGCCGTTGAACATCTTGTACGTGCGCGAGGAGTGGTAGCCAGCAAAGCTTCCCATGAACA
CGAAAAGCAGCAGCAGCGTCGTCAGCAGCGAACCACGGTTGGCCGGAGACAGCAGACCCAGCAGCGCAATAACCATCGTAGACGCGCTCATGCAGCACAC
CTGGACACCGGTGCCCACAACCACCGAGAACAGCATAGGCGAGAGCTGAGGCGGGCGGAACACATCACCGTGAACAAGCTTCCAGCCAGACTCCTCCTGC
GCCTCCTCCGTTGTCTGCACCTCGTTGTACCGGGCGATATCGCGATGCAGCGTGCGCAGCATAATCATAGCGATCATACCCGTCAGGAACAGCACGATCA
TGAGCGAGTTGATGATGGAAAACCAGTGGATCTGGTCGTTCGAGCTCTTGCTGCTGATAATACGGTCCCAACGCTCCTCCCAGACGATGTCCGACTTGAC
GAACTGCACGTCGTACGTGTAGAGCACGGTAGTCTCGCCCTCCGGGTTCAGGTACTGGTAGTTACCCTGCGACACCTCCTCAATGTTGACGAACTTGCCG
CATGTGTCCGAGTCGAGCTCCTGGCCGGCCATGGGCTCGTTCTCGTACCTGTGCTTGATGGAGGTGGGCACGACTTCGAAGCCGACGACGCGCCACTTGG
GCACGTCGCCGTCCTCCTCGGCGTACGGGTCCGCGTTGACCGAGATGATGATGCGCACGTGGTTGTACAGCAGGTACTTGCCGTCCTCGTCCACCTCGCC
CACGGGGAAGCCGCGCTTGAAAGATCCGGCCTGCTGCGAGTCCGTCGGGTCGCGGTACAGCACGGGCAGGTTGTCCACCACCCACTGCACGTAGTACTCG
TCCTTGATCATGTCGATGAAGGACTGCGACTGCTCGGACGTGTACGTCATGGGCTTGCACAGCACCTGGCAGATGGCGTCCTTCTCCATCTGCATGTTGT
ACAGCGAGTCCATGATGGCGTCGCCGGCCATGATTTCGCCCAGGTTCTCCTGCTGCTCGTTGGTGGCCGTGGGCTTGCAGAACGGCAGGTAGTAGTACTC
GTACGGCACCAGCGTCTTGGTGGACGTGATCTTGTTCACGTTGAGGCGCACGGTCTCACCCGCGGCCCACGACTCGGGCGCCACGCCCGGCACGTAGAAG
GCCGCGCTGGCCTCCTGCACCGCCAGCAGCGCGGCCAGCGCCGTCGCCGCCACGCACTTCATCCACATCGTAGCTCGGATTGGGAGGGGAGAGGAAGGGA
AGGGGGGAGGGGGGAGGTGGTCAATTATCTGCCGCTCCGCTGTTTGTTCGCCGCTGGCTTCTTCGCGGTTTCGTGGGCGGATGAGGGAGTGCGCTGGAGT
TGAGCTGCCACGAAGCCGTCGCAAGAAGGCATACCCCTGAAAACCAATAGCTGAACGGAAGGCAGGGTCTGCGAAACAGCATAAGATAGTGGGAGAGCTG
CCATCGCACCTTTTTCGGCCAATGACGGCGTGTTAAGCGACGGTATTAGACAAAAACAGTGAATCAGCAAGTGCCACCTAGCTCATGTGCACCACACCAA
TCATCACGGACGAAACCCTCTCATTTCCGTTATCTACTGGACCCCTCCTCCACGGAGTTACCGCAAAAGGCGAAGAAGGCAGCCCCTCCTGCTGCAGTTG
AAGCTGCTGCACCAGTCCGCCACTGCCGCGACCGCGCTCTCAAGAGGCCTGCGCGCAGAATCGATCTTTCTAGCCTGCTGAGAAAAGAGACGGGTCGGCC
CGAATTCCGGCCGCGAGACCCACCCAACCCGCCGCGCTGCTTCCTTCAGCCTGGCGCACACTGCCGCAATTAGCCTGCGGTCATCCTCGCTCTGATTGGA
TCTACCGTTCGCTCGCTCGCTGTCTATTGTTATCGGTCTGCTGGCTGTGCTAAGAAGGCTCTGACCTCGCAGTCGCGAAAACCAGCGCCAACTGACGGAA
AAGACCCCAAGCGTGACGACACTGCTTCCTTCCGGCACAACCTCTACAACCCCAGAAGCTATGGAGGTGGCGGTGGTCTCAGAAGCCGTCGTGTCCGAGG
CGTTGCACCAGCTCTACAGCCCGCTGAGCTCGCCGCGGGTGCGTCGTCGTGCTGACTCACTGCTGCAGCAGTTCCAGCGCTCGCCCGAGGCTGCGCAGAC
CGCGCTGGGCGTGCTGCAGGCGCCTATTGTTGACACGGGGAACGCCGAGCACAATGCGTTGCTGCGAGCCAAGCGCGCGTTTGCTGCGTCGACGATCTAC
TTCACGGTGGCCTCGTACATTCGCAAGTACAAGATGGACGACCCGGCCAACTGGACACCGGAAGATCGTGCTCAGCACGAGGTGCTGGTGAAGGACTTCG
GGCAGATGGCTCAAGATGTGTGGAATGTGCTGACGGGGCCGAACGGAACCCACGAGGAACTGAACGTGCAAACCCACTTGGCGCTGACGATCGCTGTCAT
CCTGCTGCGCTTCCACGAGCCGCAGGGCGACAGCACAGTCGTCGGAGCAGTGGAGTGGCTCGTGCAGAACCAGCAGCACCCGGTGAGTGACAACGTGACG
GCTGCGCTAACTAATTTTGCAGTGCTGCTGACGCTGAAGGTCATCCCAGAGGAGGTTGACAACAAGCGAGTCAAGTTTACAAAGGTGAAACGTGCTCAAT
GCGAAGACATGGTTCAACAGTGTGCCGCACACGTGGTCCGGAGTGTGCTGCCGTCGATCGCTACAGCTATTGATGCGAGTGAAGACCAAGTGCAGTTGCG
GGGCCTGTTGTTGCAAGCTTTTGCGAGCTGGGTGGAGCATGGAACGGTATTGCCAGCAGTTATTATCGAATGCGGGATGCTGGATCGCGCGTTCCGTGAG
TCGTTGGTTCCAGCTGCTTCGGTGTATGCCCTGCAGGTTGTACGCGAAGTTGTTCGCGCCTGTCGCCATGATGAGCACGTGCAGCTCATGGAAATGGTGA
TGCACAACTTTGTGATGCTAGGAAAGCACCTCCAGGAGCGCATGGCTGCGTCAGCGAAAAGTATGGACTTTTGTCTTGCTGACTGCGCGAGAGCGATATC
GGAGTGCGGACAAGCGTTCATCGTCTATTTTGTTGACTACACGCTCGACATGCGTCCCGGGTCTCTCGTTTACGAATTTTTGGACACTATTCTCTACTTC
ACGTCGTTGAACAACCTGGACATCTCGAACGAGACGATGGAGTTTTGGATTAATTTCCGCACGTACATATCTGGAAAGCACGAGCAACGCATGTACGTGT
TTGAAACGTTCATCTCGCGGTTGCTGGTCATCCTGATAGAGCGAACGCAGTATCCCGAGGGTTTTGAAGCCTTTCCAGAAGCAGCGAAGGAGCTTTTCTT
CCTGTACCGAAGCGAAGTGCGCAATGTGTTCCGAGCCCTTGCCACTGTCACGGTCGCTAGTGAGGACAAGTTCATTGTAGATGCTATTCATGCGATCTTC
CAACAGTACGAAGCCGCCGAGTCGGGAGCGCCTTTGCCGCCGGATGTACGTATCCTCTTGAAATGTTTTCTGTGTAGGTAGTATGTTGTGTAGCGAACTA
ACTAATTTATTGTGTTTTTCCGCAGTGGTGGCGACGCACGGAAGTGTATGTGCACGCATTAAGCGCGCTGTCAAAATCGATTCGTGAAGAAGACACGTCG
CTCGTTCCAAGGCTGTTCGAATGTTTGTCGCGAAAAGAGCCCTCGCACCGCGCGCTCTCGCGCACAGTCACCATCTTCCTTGGTGTAGCCGGTCATTGGT
TTGCCCGCCATCCAAAGTACTTGGGGACATACGCTTTCCAAATTGTGTCGAATGGCTTCGAGCTCTCCGAGGACGGTTCTGGTATCCCTTTTAGTCAACA
TGGTCTAGAAGATCACGTGGGTGCTGTTGCCCTCCGCAAACTGACGCTTCGCTGTGGCTCGCACTTCTTCAATCCGCTGTGGATGGACGCACTGGTGAAC
CTGTACCGCTCGAACCGCGCTGCAGTAGGGGGACCGTCGCCGCCATGCTTGACGGGGAATAGCGCGAAGCTTATTGTCGACTCGATCTGCCATGTTCTCA
CGACGGTGTCGTACAAGGATGCACTTCCTGTAGTGGAGGAGCTTGGAACGATCATGTTCTCGGACCTTGCTTCGCGCTACAGCCAACTAAATCCTGACGA
CGAAGGCTCCATCGAGTTCCTGTGCGAAATGTTCAACCATCTCCTCGTGTTGGCCACACGGATTCCTCTCCAGATGGACCAAGAGGTCCCGCATCCAGTG
CTGTGCGTGTTGCAGAAGCAGTGGGAGGTGTTGGCGACCATTTTGAGCGTGTACGGCTGCTGCGAGGAGGTCATTGAACCATTTTGTGCGCTGCTAGTAG
GTGTTTTTGAATCATTGCGATCTCAAGCTTTGGAACTGGCATCCGCAATCATGCCAGTATTGCTGGAACAATTCTCGCGGAGCCATGACGGTAGCTATCT
AAGCGTGATCAAAAGTATCATCGGGTGTGCTGGTGATGACGAGGCTACAGCAGTGAGCTTAACGCGCGTGATGGTGATTGTCAGCGAAAGCTCCATGAGC
AAAATTGCGGCAGACGGCAGTGTTGATGAGCACCCTGGATTGACGGCCGCGTTGTTTTCTCTGGTGGCCACGTGCGGCACGCACCACCCGTCAATTCTAG
TACAGTCGAATCAGTTGGAGGGTGTGCTGGCATTAGCGCTACACGCTTTCAAGTCGCAGAACCCCGAAGTTGGAGCCGCAACACTCGACTTTCTGCTCGA
GTTGGGGTCGCTCTACGGTCAAATCCTGCGCACCCCGGAAGCTTTACTGCAGGGACCCGAGTTTGCCGGGAAACTCCTACTTCACCAGCAGATCCAAACG
CTGTTCTTCGAGAAGGACGTGCAATACCACGTCCTCTTCGCACTCTTCAACGCCGCTGCAGGGGGCATGTCGCCGAACTTGATGGACAAGATCGCGGAGG
TCGTTCGGTCATGCTGGGTGTACTTTGGCCGGCAGAGAAGTGAAGAGCTGATCCATCGGCTCCTATCCGACAGCAACTTTTTGGGGTCGCAGGTCAGCGA
GCGTGCTCGAGCCGAGTTCCTTAATTACATCTCCACACCGACTTGTGTGGAAAACTCGCGCAAGTTTAAGCGTGTGCTAAACGCGTTTTGCGACCACTTC
AAGCGCAACCTTACGGTTAGTGTGAACGGGGATGCAATGCCGTTGTAATCGGCGATGCCAATATCGAGACCAGCGCGAACAAAATGCATCGGGTGGTAAA
AGCATAACGCGAGCACGCGAGCAGATATTTTTTAGGGATACGATGCAAAAAACTATCTCCTCTTCACGCTTGACCTTGCCAGCTGATCGTATCTACTGAA
ACGGGTTGCCAACGTCTTTCCACGTCGTTGTGTTGTTCTCCGTGGTGGCAGTGATCAAATGTCCACTCGAAGGGCGAGCAGCGTAAGGGGCGTCAGACCA
CTCCAAAATCTTCTCGCCAATGTCCTCCGCCTGTGCATTAAACACAAGCATCCGTGTGACTTCAAACACTAAAAAAAATACGCACGCATCTCTGGTTACC
TTGGTCCAGGTAGAGAAGTCCGCATCGGCCATGAACTTGCGGTTCATCGGCGTATCGATCGTCAGCGGAAGCACGCCCAGCACGGACGAATCGTCCGGAA
GCTCAGACCTGCACATGTTAACCGAAAAATTATCATTAGCGTGCCATAAGTCCACCAACACTGCAACACTTGATGATCATACACAGCGCTGGCGATCAGA
TGGTGGGTGGCCGCCTTGCTTGCTCCGTACGACACCATGCCAGGCGTAGCCTTGAGAGCAGCGGTCGCTCCCGTCAGCACTAGCAGGCCACCGGGTACCA
GCAAATGGCTGGCCAAGTACGTTGCTACAGAGTCGCAAAGGTCTGTTAGAAACCGCGCAAACCACTTGAATGCCCTGCGTCCAACCTACCCAGGAAGGCC
GACTCCAAGTTCTTGGTGTGCATGTCGCTCAAGTTCAGAAGAGAGTCCGCGTCGCGGATGCTGCCGCCAGCCCAGCCGCCAGCAGTGCACACGACGGTGT
TCATCTTGCCATTCCTGCCCACTTTAAGTAAGTGTCGAGTACTACAATAGAGTGGCTGCACGTGAGAGGGTGAACGGACCTGCTGGAGATCTCCTGCAGC
GTTTGCTCCGCCTGCTTGAGCGAGTTGCTTACAGGCAGCAGCACGTTGTTCTCGGCGTCCTCGTTGGCCGAGAATCCCACGGACGTGACGCCCCAAGACG
CACGGGCGAAGTGTTTCACCACACCGCGGCCTAGCGCACCGGCGCCGCCAACAACGAGCAGCTTCTTGGACATTTGAGTTTCTAATCCGCTTTGACAATG
CGGAGCCACAGGCGCGTTTAACACCTCAAAAGATAACGTAAAATCTCGTACTCTCTTGGTGTCATTCTGGGGGTAAATACTTTTGCGCTGTACATCGTGC
GTCTGATCTCCGGTTTCGTCTAAACTTTTCCGGTGCAGCAAGGACAATTTAACACTTCAAATTTACGGTTATCAACGTGTCTGAATAGGAGCTGCCTTCA
AACCGGCACACTAACGACGTATACATGTAGTCTATGAGAATTTCTCCGAGTGGAAGTCAAAAATCGTGCCGTTGGGGTCCGAGGACGAATACCTCTTGCA
CGTGTTGTCGAGAATCTCCTCGAGGGCGTGGGGGCCGCAGTAGAACACACCGACTTCCTCGCCAGGGTGGTTGGCCTTGGCCTCGGAGAAGACCTTGTCC
CAGTCCGGGCGGCCGAAATGGGTCAGCTGCTTGGTGCTGAGACCCGACACGAAATCCTTGCCAGTCTGCTCGTGCACGAACTCCTGGAACATCTTGAGCT
GCGAGGTGTTCTCGCTTCCCTTCAAGGTACTCAAGTACTGGTGCGTCTCGATCACATTGTCGCGGTCCATTTCGGCGATCTGGTTCATCGTTTCTTCAAA
CCAGCTCAGCGATTCCTGTCCGCGGGTCACCCAGTGGAAGTAGAGCTTCTGGATCTTGAACGAGCCTGGGTGGCGAACGTGACTGCAATTCGGGCAGCGG
TTGGCCTCCCACAGGTGAACGACATCCTTCAGAATCGAAGCGAACGGAGTAACACCGATACCACCGCCGACGCAGATGACCGTCTTGTAGCGGTGGTAGT
CTTGGGTTGGGGCACCGACAGGGCCATCGAGGTGGATATCCGGGTACAGCACCTTACGCTCATGGCAATCAGCGATCACCCGAGCCAAAGCTTGCGTCCA
GTCACCGCACACACGAATGTGAACGCTGATGTAGTTGTCGCCGGGGGCCGACGAAATCGTGAACGGGTGCCACTCATGAGACGAGATGAGCGGGCAGTTG
ACGAACATGTACATGCCCGGGCGGTACACGAAACGACGAGGCTTCTCCATGAACAGCGCGACCGTGCCGTCCAGCTCCATGGCCTCCATGATGCGCACAG
GTGCAGCAAACATCTTGGCGTAGCGGAATCGACGCTCGATCAAGTAGATCAAGAACGGAGGCGTGATCCAGATGTAGGAAGAGCTGCGAGCGAGCCACGA
GCAGGCACCGTGAAAGCATAACACGAGGAGGAACGGTCCGAAGAGCATGTGCGAGTACCAGAAGACGTTGAACTTGCCCTGGCGGAACTTGGGGATGGCA
GCAAGCGGGAACGAGATGCACGTGATCACCAGAAGAATCACACCCGTCCACACTGGAAGTGACTGCAACATCGTTATGAACGGAGGGCGTTCGCCGTTCA
CGAAGGAAGACACGTGACGGGTCACGAAGATCGAGCGCTTGATCTCTTCCGGGGTGGCAACCAGGTACAGGTAGATCTCGTTGAAGACGTGGGCGATCGT
GTGAATGAGGCCAGCGGTCAGGAGAACGCTACCCGCAATCTTGTGGAACGCGATGCTGTCGTCGAACGGGATGTAGCGCCAAAGGATGCGGCTGCGCTTC
ATCACCTGCGTGATGGAGCGACACATGGGCAGCAGCACGAACACGCAGTTGACCATGGCAACTTGGGCGTTTGCACGGGCGATGCGAAGTCCCCAACCGA
TAGCGGGGTCAACGTCGTAAGAGAACCACTTGACCCAGAAGGCGATGTTGTTGAGAATGGCGTAGAACAAAAGCCACCAGATACGCAGCTTGTTGGCGCT
GTACCAGGCGCCGAACTTGCTCTTGGGGCGGATAGGCGCCGTGTAAACGGGTGCTGACTTGCGGAGGTTGTACGAGTCGTTGATGTACGGGGCGAACACC
GTCTTGAACTGTTCGTACGTCATGGACTCATTCTTTACTTGGGCCTTGCGGAACATGAGCTTGGCCACCGTCTTGAAGTCCGTGCCAACCACGTCTAGGT
GAGCGGCGGAGAAGTTTGACTCGAGAAGCTGGACGATCTGGTCTTCGATCACGTAGCCCGAGTTGTCCGGGTCGAGTGTTTCAAAGATGAAGCGGAGTTT
CTCCTCGCCATCCACATTGAGGTCCATAACGGCGTCGATTAGGATGGCGTTACCGTCGATCGCTCCATTGCCCGTGGCGTATCCATCGAAATCGTCGCCA
TTCAGTTCGAAGGTCTGCGAAAACGTCTCGCGCTCGATGTACCCGCCCTTGCTGGTGATGCTGCTCATAACATCGCGGAGTGCGTGCAGCTTCTCCATGG
GGGTGTACGACGGGTCGTTGGCGTGCATCGCATGCTCATCCATGCTCATTGCGACGGTGTACTTCTGCTCGAAGTTGCAGTCGCCCAAGACCGGCACCGA
CACGACGTCGGAGCCGGGCTGCGGGCCGTACCGGGATCCAGCGAATGAGGACAGATTGGACGCGCGCGCTAGACTCTGGCGCACCATGGAGGCGCCCAGC
ATGGCCTGGACGTTGGGTCGGCGGCGGGGGCCGCGGCTGCTCTTGCAGTTGGCGCTCATCTTGGGCGGGCCGCACCCGATGATGTGTGTGTTCGTGGCGC
TCGGGTTAATGAACTGGCTGCTATCCATGAAGTTGGATTTGGCGGTGCTCCGGAACGAGGAGACCATGCTCGGGTGGCTGCTGCCGATGGACGGGTGTCC
GAACGACGGCGGGGGCGGGGGCGGAGGCGGTCCTGGCACGCGCTTGTCCTTCATGCTGCCCCTCTTGCTGTTGGACCTGCCATTGGACCTGCCGTTAACT
CTGCTATTGCTCCTGCTGCCTGACCTGCTATTGGAAGACTTGCTGTTGGGCTTGTGCTGGAACTGGCGGGCGTGCGGCGAGGGCGTGGAGATGTCGACGA
ACGGCTGCAGGTTCTGGCCGGGCGTGATCTTGAGCTCGTCGGCTGGCTGGCGCGCGGCAGCGCCGCCCTCCACCTGGCCGCGGTTCTGGCGGTCCATTAG
CGTCCGCCGAGGCGCCTCGTGTCCTTGCAAAGGCGGCGAAGAATGCGAAGTGGCCGACCGGCAGTCAAGCGGTCACGACGGTAGAAGTCCTCGCACGCGC
AACAACGGACCCTGACGCTAGAGCGCTAGGTTTAGAAACACGCACAGCACCTGTGGGCCGGGAAAACAGGCAGGTGGCACTGCCGACGGCCTTGCAATCG
CGAAATGGTGAAGTGGCCGCCGAGGCGGCGTATCAAGGGCCTTGATTCAAGGCATCCCGGCCCGCTGGCGCTTCCACCTGGTCGGCGCGCAGCCCCGGCC
ATGCGCGCGAGTGACACGTCAGTAAAGTTCAGGCCCACCGAACTGTGACATCTTGATTCTTGTATGGGTAGACCGTTCTATGCGCCGTTTGGTCCGACTC
TTGCAGCCAAGCCGAGGATACTTTTCGGATGGTGCCGCCACCAGCTGGCAAAACGGCACAAGCGCGTTGCACTTTCCTGGTGACGGAGGCGCAGAGGTCA
AGTCGCCGCTCTGCTCTCTGTTGCCACATTCACATCTTGACAGCTTCGGGCCGCCAGCCACTGGCCTCGAACTTGTTTGCTGGCGAGATGGAGCTTTAAC
ATGAAGCTGCGGCCGCACGCTCGACCGAACGCAACGCTATTTCACTGCGTGCCGGCAGCGATGTCGACAGATTTGAATACGGTGAACCAGATATATCTCG
GTTGTGTGGCCGTGGAATCGATGCCAGATCTTGCCATTCCGATGGTGTAGCCATTCGAGTAATTCACCGCTAAAATGCCAACGTAACCGACTGCAAAGTG
CAGTGGAGGCATCCGATTTCCTTGTTTCAATGTGGCTCGCATTTTCATCCTTCATCACGAACGACTACCGTTGCTGCGAGCCTCTCCACCAGTGAACCAG
CAATGCTGGTCCAGCATTTGTGCTCCCGCCGGGATCAGCTTGAGGTCTCGCGTGTCTCTATGGGGACTTCTGGTCTGCCAGGAACGACAATTTGTCGTCG
ACATGGCGATTTTCCTGTTAGCTTACTTACACGGTGGTAACAATCAACTGTAGCCACCAAAACATTGCAACCATTCCCAAATTGTTTTGAAAACCGTCCG
TAGTGGAAAGTCTTGCAATCACGAAAAAGCAAGACTTAGTCGCCGCCTCGAAATATGGACGGTTGCCCCAGCCAGCAGCGAAACGGGGATAATTAGCGAA
GGCATTGCAAGCGTTGTGCCTCGTTACACCACGGCCGTTGGCAAACCACGACGCCAAGTTGGTCCAGCCCGAGATGCTCCGTGTGATCTGTTTGCCCGCA
CATTTCGGCGGCCTTCGGGACAGCCTCGAATGGATTCGCGCCGGCAGCTCCATACGTACATTGTAAGACATGGCTAGCGG