Description :
From Genome Similarity Track
Location :
Scaffold_404:5709- 10155
Sequence
4446 bases(100 bases per row)
GGGAGCTCCAGTGTCTTTACCGACACGCGAAGAGCTGCACGATCCGCAGCCTCCACTCAGTGGATTACGTGCCACTCCACGATCTTCATCCGGGCAAAGC
CCCTTGTTATTCGGCATCATACCGACCGTGCCGTCGCTGGCACGCAGCAGGGCGTCGCCCTCAGATGCACGCCCGCTCAGCGGAATTCGTGCCGCTCCAC
CTGCCGTCCGCAAGCCACGCTCGGAACGTTCGTTCTCGACACACTCAGTGTCCACCAACTCGGAAACTCCGATGTCCAGCACATTGACCGACTCGGTCCA
GTGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGATGGGTTCATGACTCGCCAATGCTCCGCCAGGAGAGAAGTGCGTAGCACCAAGGGTCTTCGAC
CTCCAACCGATCCAAGGCTCGTGGCGTTCCAGCCACGCCATACAAAGGATGAGATCATATCTCGAATCGAGGTCTAAGACCAGACAGCGTTCCACGCTAT
CAAAATCCAAAAACTTCACGCCCAGGTCCACAGGGACCTTAGGCACCGTGACACGAGTGCCCGTCGCGAGACGAACAGTGACGATGTCACTCCCGCGCGC
TACCAGCGCCTCAGCATAAAGCTGACTTCCGTCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGTGTCCGAGT
ACTTCGCGGCGCAACGCCTAAAGCGCAGCTTGCAGCGCACAAGCCCCAGCTCTCCTCGAGCACCAACCCGCCAGATCATGGATCCTAGGGAACTCTTTGG
TGAAGAGGGCGAGGTGGACGAGTCCATGGAGGGTTTTCCGAACCGAGGAGATGCGTCCCCACTCACGCGACGCTCCCCGAGCCGCGGTAACGCTTCGCCC
ACAACGTCGACACGTCGTGAAGCAGCCTCGCCGGCCCCAGTTGGCTCTCCGAGCCGTCGCGATCAAGAGCGCCCCGCGCACACGCCTCCTGTGCGCTCGC
CGAGCCGTCCACCTGCAGAGCGCGCTGCGCCGTCGAGGGAGGGGCCGCGGCCACCGCTGCGAACTCCGAACCCGTTCCCTGAACGCTCATCCGGCCTCTA
CGAGCTGCGCGCGCTCACTGAGCCACGGTATTCGCCACCTCGTGGTGAAGGCGTGCCCCTGGGCCCCGTCATCTCCAACCCTTTGGACGAAGCTCAGTCC
GAGCAGGTTGCGGCACAGATGGCTCCATGCGCTCCCAGCGCCCCGAGCTGCGGCCTCTGCAGAACCCCAGCACTGCTGACTACGGCTCCCGGCCTCGCGA
CCCCGCGGAGGCTTGTCGCCAGGCGTTCCAGCAGTCTCTCGCGCTGCACACCATTGGGCCCGCGGCCCGTACTCCGGAGGAGCTCGCACTGCGTACGTCT
ATGCGAGAGCGGCTCCTCACTCCACAGTCTACGACTGTCGCGGAGTATCGCGAGAGGCTGCGGTTGCAAGCCCAGCAGAAGTCCGTGCCCGCCATGCGGA
CGTACCCGGTGGTACTTAGCCCGGGGGAAGACTCAATTGAGTACGAAGCTCAGTTCGAGTCTTGGGCCGAGCACAGCCGGAAGCTCAGCTCCATGGACGC
TCTCCGAGCCAGCTTCAATGAAGTGGATGTTCGCATTGAACGCAAGCTCCGCTTTGATTTCGCGAAGGTCCGAGCTAAGCGCAGCCTCTCGGCACTCGAC
CAGCCGCAGACCCAGTTTAACGCTGCGCGCTTCGCTCCTTCGAGCGCTCCAGCCGCTCCTTCCCGCGAGGGAGTGAGCGCTGTGGCTCAGGGTCAGCCTC
GAAGCAATGTTGCTGACCCAGCAGCTCCCCAGCTTATTGCCGGGAAGCGCGGGACGGCCGGCGTACCGGCCTTGAGCCCTCAGGGCGCTGGTGATCAAGC
TGATCAAAAGCGTCCACGACGTCTGGGCAGTCTTGGCGTCAAACTCCCATGAGTTCTCGGAGTGAGGGTACCCTCGCCATTTCACCAGATACTGGTTTTG
ACCCCGGCACCGCCGCTTCGCCAGGAGGCGCTCCACATGGTAATGTAGATTCCCATGCTCATCGAGCAGGGCCGGTGGAGGCCGCTGTGGGGTCCTTTGC
GACTCAAAGTGAGCTCTGGAGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTAAATGTATCCGGTTCACTATCT
AGCATAGTGAACCCTAGTCATATGCATAATCAGTGGCTCTGAAGCCATGTACTGATTCTACTACTAATTTAGGTTAGACAGTGTGTACCCACTTCGTAAC
CCTTCGGGTAACTCTCGTGTAACCCCGTTACAACTTCTTCAATACATGTAGCATTTTTGTGCCTTTTAGCATAATCGGCTAGTCTTGAGCACATTTTAGA
AATTGCCCACGGCTGCTCAAATTCAAGCTTCGTTGGCAAGGACTACAGTCAGCATCCGTTTTCAGCGAAGCGAGACAAATGTACGTGTAGAACTCGTCAC
GAAGCCTGCTTAGGTGATGAAATGAGAACACTCAGCGGGAGAGGTGGCGAGTCTGCTGGAAGTTTTGAGCCGAGTGTATTGTTGTTGGTGCCGTACGAGG
CAAGATAAAGAGTCGGTATGTGCCCTACGAGGCAAATTGAAGGCTCTCTAGAATGTATAGACTATTATTTTGTACTGGCCATAATAGTTGAAGCCGGAGT
TCGGAGTCATTTTTCTCCCAGAAGATGGTAACTTTCCATATACGATAGTTAGATACAAGGGGTAATTTTCGCCGTAGATTCCGATTCTGCTGTCAGATTT
GACGAATTCGGACTCTTTGTACGGGTAATTAAGCCTTGAAAACATGACCTCAATTGCTCAAAAGTTTGGGGATAGGGCTCAAGTAGGGTAAGCCAATGAC
AAACCCAAGAACATGCACACTATTGGCTTAAACGGTAAAGCATACGCCAAAACAGACGGTGGTTAGGTGAATTGACTGCTCTTGTTCACATTCGCCCTGA
GATTGCCAACTTGCGCTTTGTAACATACCGTCGTGTTTGCATAGGATTTGTATTTGATTTGACAATCATGGATAGACTCTTTTTATCTTGCTGTGTTTCG
GTAGTCGCTATTTCGGGAGAAAATACAAGTTTAAACAGGTAATTGATATGTACCGTTAAGTATCCGAAGGATGCCTCGGCGACGACTTCGAGGAAGTTTG
CTGGACTTGGTACGCGCTCCTGACGCGAAACGCCCTGCTCACATCGGGCCTAATACACTTCACTACCACTTCGCGCGCTTACCGCATCGTCTTAGGCTTT
CCTTTCACTGTTAGGCTCGAAGATTCATTCATAGTGATTATGGCAACTCCCTCATCGGCATTTACTTTCAGGCCAATATCCATTCGTTAGGCCCTGGTGC
CTTGCGCTACACTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACTTCCGTCCATCGTAGAACGCCGGGCGTA
GTTACCCGACGCCCCCGAATCGATCAAAATCGTCCATGGCTTCGTGAAGCCCTTCACNCAAGCTTGGACAACTAGCAAGCCCGGCTTGCATACACGTTCC
GTGTTAGAGAGTACGGCTCTCTTCGGGGCTAAGTCCTGTCGACCTCCACCTCGCCGAGGCTCAATAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGC
CTACTGGGACTTCTCGTTTCCCCGAGACAAACCAGAGCCCTGGCTCGAACTCGAAGAGCGGCTTGACGAAGCCTGGCGCTGATGGCGCAGCGGACACCCA
GCACGAAGGTGACGGGTGTCACCACAGATGAAGCATCTGCGGATACCGCGACGCTACGAAGCTCGGCTTCTTCGTCTTCAGCATAGCTGAGGTCCATGGG
TTCCGGACCACTCGACGCGCTAGCGTAAGACGCATTCCACCCAAGTCTCGACGACTTAAAGTTGTGCTCCGCATTCAATGCGACGCTCACAGCCTCTTCG
AAAGAGCTCGGGTGGGTTCGGAACACCTCCGTCCTGGCAACGCCAGTGCGGAGGCCCTCCATGAACACCGTAACGGTGACTGCCTCCGGCAGAGGGTCCG
CAGACATACCAGCAATGAGAGTTCTCAACTCTTGGAGATAGTCCATCAACTCCTTCTTGCTCTGCCTGGTCGCCAGGAAGCGTGAGCGCACGCGATACGC
CTCGTTAGGCGGAGCAAACACTCGGGACAATTGCTGTTTCAGCTGGTCCCACGTCGGGAAGGCCACCTCGACCGACGTCCCGGACGTTTGTGCCCACTCT
CTCGCTCGCCCACCGAGCTTCGAGATGGCTAGTACCACGCGCTGCGACTCCGTCCGGAGTCATAGCCATCTCAACCTCACGGGTCCAAAGCATCAAGCTT
TCACCCTCCTTGCCTTCGAAGGTCTTCACGCTCAACATGAGCGGCT