Description :
From Genome Similarity Track
Location :
Scaffold_14:570862- 572184
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08538hypothetical protein

Sequence
1322 bases(100 bases per row)
CTTTAGTCGCTGTCATCGTCACTTTCGTCCTCTGAAGATGAGAGACTGAGCGAGATAGTGTTCGGAGCCTCTTCGTCACTGTCACTCGAGTCGCTGGAGC
TATCGCTATCAGCTGTGCCCTCGTCGGCCTTCTCGCCCTCTTCCAGCTTGCGCTTCTTGCGTAAACTCTCGACATCGTCCACCACTTCGTCGTCATACAG
TGCTGCACGCTTCTCAGGCAGTTTAAACTTCTTGCGCAACATTTCCATTGCGTCCGGAGGGAGCGGGTCGCCTGGTTTCCACGACTCTGGTAGTATAATA
CCGTGCACCGTGAAGAAACTCCGACCCATGTAGTGCAGTAGAGCATCGAGCGGTAGGTCCACGGGGTCGCCTGGCTTCCATCCAGGTGGTATTTGCTTAC
GAATCTGCGCATCACTGGCACCCAAACCAATAGGGATATTGAGCTTCTCGATGGCTTCACTGTCGCCGTCTTGCTTCACTCTAGCTGCAGTAGACGTGTA
TTTCTCCGGGCCCTGAGTAACGATCTCAGCGACGATACCACGACTGAGTACACCCGCTCGCATCATGTGCTCTTGTGGTGCTGGCGGCATGAATCCAAAC
ATTGGGAACTGTATAGTAAATCACCGAAAAATCGTTAGCAACGTCACATACACTCAACCGAGTGATAACTTTACGTACGCCAGGTTGCCACTCTTTGGGC
GCTGATGTCGTGCCCGCAATACGGTGTGCATATGCAACAATGTCGCGTGGATCCAGCACCACTAAATGACAGAAACCACGTCACAATTATTGATCGAGCA
CCCTCAGAGACATATTACTTACCTTTGGACTTTTGCTTCGCGTTCTGTAGCACAACACGGTGCTTCCTCAGCACGTTGGCGATGTCCTCCTGGGAGCGAC
GCAACTGTGCAGCATACTGCACGACCTTCTGCTTCTTGTTCTCGATCTCGGCTTCAATGCGCAGCAATTCCTTCTGAGCTACTTGGTGTCTAGCCACTAA
AACGTCCAATGTCAGTGTCAATTCGTCTCCTGATCGCTCTAAATCTCCCCAAAACGTACGCTTCTTAACGGCTGCGAGTAGGTCGCGGTCTTTCTCGAGC
ACTTTGTTGAACGTCTCGTTCACTGTGCGCAGTCTCGTGGCCGTGATAGTGGAGGGCGGTCTGCGGTTTAAGAGCAGCAGGTAATGTCATTAATACGGGC
CAGAGATCAGGTCTAACGGGTATTCGACCACGTACAGAGAGGCCGTGTTGAGCGACTCCAGCAGCTTCGTCACGAGGAAGCGGTGCTCGTGCAGAGCCAC
CTCCATCTCCTCGCGGATGCTC