Description :
From Genome Similarity Track
Location :
Scaffold_53:57085- 58311
Sequence
1226 bases(100 bases per row)
CTCTCGGACGTGCTGGCGTACGATTTGCTGTTTCAAGGTTTTTTCAGCCCGAGTTTGGTTTCTGCGTGGGGAATGGATAAGACCGAGCTCACTGAATAGG
CGTTCGCAGGAGGCTGTATTCACAGCAATTGACAGAATAGTAAGTGCAAGTGTCGGCAACTTACTATTTGGCTTGTTCCGTTGAAGATAGGTCCAGTACT
TCATGATAGACCCTTTGAAATCGGCCAAAGGAAGACTGGTATAAGTTCCCACAAACCAGTCTAACATCTCACCGCGTAATTCAGTCACGTCTTCACTTAT
AAAGCGCCGGTAGTAATACAGCGCAATCTCGCAGACCTCGTGTTCAGTTGTCAAAGCCGTGGGGGGAAATTGGCGAGCTTGGGTTGCAAATATCGGGTGC
AAGACGTATCCCAATACAAACAAGGGCTGCTCACAGGCGGACCATCGTTCTTCAACGCATTTGACAAGTGTGTCAGCGTGCTCTCCTGCTGCAAAACCTA
GGTAAATATCTCCGAACGACCGCAGCACATCTGCCAACGTGTTTTCATCACGCTGCAATCGGTAAGACGCAATACAAAGAGGGCGAATCACCTTTTCTGC
TGCCTCTAAATCACTCCAAAATTGCTGCTTGCCTAGTACGCAAAGCTTGTCCGGGAATTCAGGGTCACTTCGGTAGGAGTACGCAAAATCCTCTAACGCT
ATCCTCACACGTAATAATGACGCGAAACACTTTTGCATCGAGTTCCACCGAGTGATGCACAATGGACACAATGCTGGGGCCGGATCTCTTCCATAGCGCA
ATGTCATGAATTTGCTGGCTCGAACAAGCCACTTCTCGGACGAAGAATTTAAAACATTAACAACCGCTGCTGCTTGCTCCGACACAGTCTTAAATACGCG
CTTTAAAACTGTTTTGACGATATTATTAATATCGTGTGCAAAACAACGCAGAAAACAAATTTGTGGCCATCGCAGTGCCAAAATTCTTCTTGCTCGACCG
CACTGTCCTGCGTTATCCGTAACAATTGCACCGACGTTCCAGCCTCTTTCTTGCATTTCCACCAAAACATATTCCATTTGTCGAGCCAGTGCTATAGCGT
GGTGCTCCGATCCAGTAGGTAAAAGTGCATAAGTCATAACAACTCCATATAACGAAAGTTGACAACCCAAAAGGTGTTGTTTCGCAATATTTTGCCAAAT
ATCCGAAAGAAAGTTTACACGTCCAC