Description :
From Genome Similarity Track
Location :
contig_51:57083- 58275
Transcript NameFunction/comments
g10100.t1hypothetical protein

Sequence
1192 bases(100 bases per row)
TTGTGTCGAGGTCAATGAGAGGAAGCAGTTTTCGATCGAACGTGTCGAAGTAGTGCACGCTGTTAACGACAACGCCCAGCTTGCTTAGTTGTCGCGCAGC
AATTTCATCGCGAACTTCATCGAGAGCTTTGGTGACATAGCTTCCAAGGTAGTACTCTTTGACCGGGATAGCACTGATACCAACCAGGACGAGCACGAAG
ATAGCGACACACGTTCTGTAAGAAACCTCGAAGTCGCGGAATGCTTGTAATCGCGTCACGAATCGTGTGGTTCTGCTGTTATTGTTTGAGGGTGGCGTCG
GGCCATGGGTTGCGCCGCTTTTCCTCGTCATCACGGGTCAAGAATCTAGCACAATAAAGTGGAGTGGGTAGCTCGCCCGAAATGGTCAACTTGACCAGTC
AAGTATAATTAGCGGGTTGGTAAAATGACGTTTGTGTCAAGCTTCAACATCTCTCGTCTCGAGTTTCTTACTTTTCTTAGCGGCTGGCGATACAATTCTC
CCCTCAAGTTACATTTCATTAGCTCAGTGAGCTACTCTTCATCTTGTGAAAAACCGAGGAGGCAAGGGAGTGCTTACGTTCACCCAAACTGCTGGCCGTT
GTGAAACTGGAGCCATAGCTCGATGAGGATGAAAGGTAATAGTCAGACGGTGATGATGAGGCTGAACGAAGCGATGGGTGCCCTGGCGGTGGTGGAGTTG
TAAGGCTAGCACTTTTTGTCGGAGACAACGTAGAGACCATCGTCGGCGCGCTGGATGAAGACGCCGCCAATTCGCAACTCTTGCGGCGCTTCTGAACGCA
CCCAATGCACACGCGCACACTTGTAGAACCCACGTCGGGGAGCGCAACATCCATTTTCGGGCAGCACTCAGAACAGCAGATCTCACCGCACAAACGGCAG
TGGTGACGACGACGCGAAAGACCAAACTTTGCATCACAAATACGGCAACCTAGACGCTCACGATTGTGCACCCAGTGAGGCGCATTCACGAGGAGTGACT
GTGATAAGCGTCGGCTTGTGAGCACCTCCTCCAGTCGTGCAATCCTGGCGCAGAGTGCCCGAAGCTTTGCTCGCCGAGACGCCATCGGCAATTGTGCTTT
CTCCAAAATCGAAGCCACAAATTGTACCTCTACGTAGCCGTCACGACCGCGAGCCTCGCGAACCATGAAACCTGTAGGCTGGAGGTCCGTTG