Description :
From Genome Similarity Track
Location :
Scaffold_57:57081- 61113
Transcript NameFunction/comments
Physo_137745putative polyprotein

Sequence
4032 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCGGCTTGATCGCCAGCGCCCCGAGGGCTCAAGGCCGG
CACGCCGGTCGTCNCGCGCTTCCCGGCAATAAGCTGGGGAGCTGCTGGGTCAGCCACATTGCTCCGAGGCTGACCCTGAGCCACAGCGCTCACTCCCTCG
CTGGAAGGAGCAGCTGGAGTGCTCGAAGGAGCGAAGCGCGCAGCGCTAAACTGGGTCTGCGCCTGGGCGAGTGCCGAGAGGCTGCGCTTGGCTCGAACCT
TTGCGAAATCGAAGCAGAGCTTGCGTTCAATGCGAACATCCACTTCACTGAAGCTGGCTCGGAGTGCGTCCATGGAGCTGAGCTTTCGGCTGTGCTCGGC
CCAAGACTCGAACTGAGCTTCGTACTCAATTGAGTCTTCCCCCGGGCTAAGTACCACCGGGTACGTCCGCATGGCGGGCACGGACTTCTGCTGGGCTTGC
AGCCGCAGCACTCCGCGACAATTGTGATATCGGGAAATGACCGAGAACAGCCCGCGCCGAGGCCTAACGGTCTTGAACCTTCGAGTGACAACCAGCCGAG
CACTCTGATTGGTTACTCTCCTTCCCCGCACTAGAGTGACAGTTGGACAGCCATTTAGTGACCAGGCACAGCGGGTCATAATAGATCCCCGGTGAGCCCT
CCAATTAGTCATAGTGGGTACAAGATTTGCCTCTCATTATGAATCCGGTCCTAGCCGAGGAGTCGTCGAGTCGTCGGTCCGGCTCGAAGGCTCGGTTGAT
ACTCGACATTTGTATAGACATTAGGGATTAGTTATAGGGAAGGCCTCACAGCCTCTAATCACTAAATCAGAGCAGAATTCCCCCCCGAAGCCACACAAGG
ATCAAGTCCGTCTACCGGTAAGTCTTAGCTTAGCTGTAGAGTCTGGATACGCTCGGCCGACGCGGGGTATGCCTGCCGGTGAGCATAAGGTACATTGGCC
GAGTGTTCATCCCTGGAAAGGCCAAGAGTGAGTAGTGGCCGAGTGTTTGAGGTATTAGAGACCTCCTTGTACAGTTGTACGTTTGTCTGGGTGTCCCCCA
AAATATTTGACTTCCAGCCGAGGCTTCGCCCCGGCGCCCCTGTCCGAGGCCTCGATTGGCCTGGTACCCTTCCTTCTGAGGGACCACAGTGGGTTAAGCG
TGAAAGCGCGTGTGTACATTGCATCCTAGTCGTAGCTCGTGGCTAAGGGTGCTCTTATATTTGATTTACGGGCTCTACCTACCTGACCGACGACTCGCAT
AAGGCACATTCCAGCCCGGTGTAAGGGAACGGGTCTGGTCTTCCGATTTAATCCCAACAATAAGCGCCGACCTTTTAGGAGGGAAGCGTGTTGTTGGAAG
GGCTCGTCCCAAAGCCTTGGCTAGAGGGACGGGGACTCGTTAAATCGTGTTTTCCTATACGACAACTGGTGCCGCGACCCGGGACTGGTGTGACCATACT
GTGTGTTGCGGTCTGTGTTGGTATTGTCCCAAACGAGCATTGAGAGGAAGAGAAGAAGAAGAGAAGAAAAGAAGAAACAAGAAGAACAAGAACAAGATGG
TGAAAGATCCAAGTCAGCGGTGCCAGCTACGCCGGCAAATTGGGACGGGGATCGACCGAAGGCTTGTCGACGATCGCGAGTGACATGACGTCTCGGCTGT
CGACAATCTCCGAAGGGTCGGTCCGTTTCGAAGAGTCGGTTGACGAGGATTCGGACGCCAACGATGACATGATGATGAACTACGACGACCTGGAAGAGAA
GACTCCCGCGATTGCGGATGAGTACGAAGACCAGGAGGAAGCGATGGTGTCGGCTGGACGCAGTGGGGGTTCACGCTCCCTCAGCCGAAACCTCGTCTCC
GAATTTGATGAAGTGGCGCGGCCGGACTTTGCAGACGATGACTCCGAGGATGGCACCGAGACCTTGACTTCGAGGGCTCTGGTGCAGGTTACTAAGGATC
ATCGCGAGTCTCAGGGAAACCGGCCTGCGATGAACAGCAGCACCCCAGCTGCGAACAAGGTGCTCGGCCGAGTGCTCGAGCAGATGATGGAGACGAGTGA
GTGGATCCGTCAGTTCAATCCAGAGGGTGTGCGCCAGGCGACGTGGACGGAGCTGAAGGAGGAGTTGCAGCACCCCGTGGAGTCGAGTTCCACCACTCAG
GTGGTCGAAGACACGGTGTCACTCCTCCGAGCCATGGGTTTCGAGCCGATGACTCGCCCGTCCGAGACCTCGATCAAGGACTGGCCGCCAGCTATCGCCG
GCAAGGAGTTGCATAAGTAGAAGAGGAAGCTTCGCCTAAGCTTTGGCGAGACGGACCTCACTCTGGGACGTCTGCCAAGCGCCCGTCCGGCGAAGGGGCC
AACCGATCCCTCGAAGATCCCGCTCCCGCAGACTCCGAAGAAGACGACCGAACGTTCGAGCAGACGCCAGACTACGGATGGAGTATTCTCTGTCAAAGCC
GAAGGCACGCCCTACTTTCAGGATTCGCATATGGTGACCCCTCGGTCGGCTACCCGAACCGAGCGCATCGCTCGTGAAACCGAGGGTACGCGAGCCGAAC
GGAGCTCCAACCGAAGTGGCTCAAGACGATCGAGCCGTAGGTTCACACCGCGCGACGACTCTTCGTCGAGCGATGATGACGACGGTGCGCCTGACTACGA
CGGAGGCTTTGACATTTCTAGCGACGAGTTAGCCCGTCAGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTCA
GCTCCCCAAGAAGACGAAGCGTTGGTGGAAGCTGCTCAGTGATGCTTTCATCAAGTATTACTGCACGCAGTTCAGCCAGTCTGCGAAGGCTCGCTACTAC
TCGGCGCGACGTGACGGTTTGGAACATCTGTGCGACTACCTAAATCGGCTGAATGGCTACGCTCGCAACGCTGGCCTTCAGTTCGAGAAGGGCGGACGCG
ACGCGAAGGATCATGTGCAACATTTCCTCGAGACGTGTGGTGACCGAGGACTCGAGCGGCGGCTTTGCCACGTTCGAGTCACGGACATCCATGAGCTTGA
AGACATGGTTAACGACATCCTCAAGTCGGAGGAACGTGGACACGGCAGGGATGCCTCGTCGCATGCCTCGTCTCATCAGTCACGTGGACGCGAACATTCT
CGCAGACGGGACGAGCGTCAGAGCGAACAGGCGCGCGACAATAGCCGCCCTGAACGTTACGAGCGCCGTGACCGAGACCTCGGACGCCGTCGTGAGGACT
CGCGCTATGCCCCACGTGTGTCGCTGGCCGAGGCGTCGCTTTCCGACTTGGTGGCTGAGTTGCGGGTCCGTGGGACGAAGAGTGGTCGATCTGATCGCCC
GGATCCCCGCGGGCAGTCGCGCAACGACAGTCGAAGTGAGTCCAGTGGCAGCCGATACTTCGAGGGCGACCGAGGCTTCAGTGACTACAGTGACGTCGAC
ACCTCGGATGAAGAAGGAAGCCATGTCGCAGCGGCGAATGAGCAGGAGAGGCGTGCTGCAGCTGAAGGAACCTACGCCCGGTCCGACCAACGTCAAGGCA
GGGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTTCGTTGACAACACCATGGCATGCCGATCGACATTGTGTCG
GATCGAGACCCGCGCTTCATGCACACCTTTGACAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGGCGGACGG
GCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGGGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCC
ATCAACAACTCGGTGCATGCCTCGACCGGGCA