Description :
From Genome Similarity Track
Location :
Scaffold_1469:5708- 7693
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1469-fgenesh-gene-0.1GAF sensor protein
Pytiw_DAOMBR242034maker-piw_contig_1469-fgenesh-gene-0.2Conserved gene of unknown function

Sequence
1985 bases(100 bases per row)
CGGCGTCCGCAAGAATCGCGTCTGCTACACATGCGCCAGTCGCATCCAGAACTGCGTCTTCAAGCCTCAAGGGTCCCTAGGCACAAGCAAATCGACTGTA
TCGACTTGGTACGATACCATTGAAGAAGATGATGAAGACCACTACCAGTCGAAGCACCAGAAGCTCGATCGAACGCTGGTCTTACCCGCTGACGGTCTCG
GATCGCCCAGGCCCGGGCATCAGCTCGCAGACGCGCTCTTCTCCCCACATCCTCTCGACCGCGCCAGAGCTCTCGAGGTGCTGAAGAAGGCAGTGAAGCA
GGTCACTGAAGAGAAAACAGACGTGAGCCAGCCCCTCGACCCGGTTCTCATCGGAAAGTATCTCGAAGCGAGGCAGCGACTGACTACGATCTCGTCAAGC
GACTTCTCGATCGATGACTTGGACAGCGGGCGTTCGTTCCCAGTTTTCCACCAGCAAATGCTTGGAAGCGGCCGATCCGTGGCTTCCGACAAGGAGAGTC
ATCGGTTTTTCCACTTGCCGATCGAAGCGGCGCACGATGCTCCGAGCTACGATGGTGACGGGCTTGACGCGATCTGTGAAGTGGCCGCGCAGCGTATGGA
GTGCCCGATGGCGTTCGTCTCGGTGTTGGGTCACGATGAGCAGCACGTGATTGGCGCTTACCAAGTCCCAGAGTGCTCGTACCGACTGCCACGCAACCAA
AGCATCCGGTCGAATGGACTGCTCGCCGATGGCAACCCTCTGGTCGTGAAGAACCCGATGTTAGACCCGCGATTCCGACGGATGCCGATCGTCCATGAAG
CGGGCATCCAGTTCTTCGCGGGTTTCCCGATCAGGGACCGGAACGACATCGTCGTGGCGTCATTGTGCACTGTGGACACGAAGTCGCACGACGACATCTC
GCACGATGACGTGTCCGCGATGACCGCGTTGGCAAAGCTCGCTGCCGACATTTTCGACGAAGAACAAGACGCGCCTGTGCCATTCACACCACGAGGTTGC
TTCTGAGTGCTCCATCTTCGGCCACCGTGGTGTCATCTCAATATCCGTCCAAGCTTCGCTCAATTTTTGTGATCAGATGTCTCGATGTGTGTGCGTGGTA
TGTTGGGTTCATGTTGCATGGTTTTGCTGCGTATTCCTATGTCTGAATGCAATATGTATGATAACCAAGGTTGCTGTGTCGATCCATGAGATGATGCTTC
TGCCACATTGGCTGGCTGAACTGATAACCTGGTGACTTGGGCAGGTCCTATCGGATTGGCGTTCTAAGTTTATCTCAAGCGCTTCACACAGCTCGACTTA
AACGACGGCGAGGAAGTGCTCACTGCATTCATCCAGCACCAGCGCCGCGCTTGAGTTATTCTTCGCTGCAACCATGGACGAGGACCAGAATCACCAGGTG
ACGCATTCCTCTTAGCCTTCGTGCTCGATGCTCACTAATCATGTGCTCTTGTATCGACGCACAGCTGCGAGATGATCTCCAGTTCGCGATCGTGAAGCTG
GAGCAGCTCACGGTGCTCGACCCAAAGGCGCCGCCCAGTTCCAAGATGCACCCGATGGAGATCAAGAACCTCATCGATATGTTTGCGGTCTTCGGGTACA
CGGCCGACGATTTCATCGACAAACATGACCAGTGCACAATCTTCAAGCGCATCCGCGGCGAGCTTGACGATCTACTGCGTGACCTATCGACGCACACGAA
GAAATACGACAAGGCTGCGCTGCTACGTGACCACCTCAAGCTCATCAAGAGAGAGTTTATCGACATGCAGGGCAAGTACGAGATGCGGCGTCAGGATCAG
GAGCAGAATCAGTTCCAGCGAGGTGTCGCCCTGGCTCGGAAGCGTACCGATTCGACCTGCGACGCCCGTACAAGCGAAGCTGAGTGCGAGATTCAACACA
AGCGCCAAGACTTGGAGAAGACGCACCGCGTCGAGAGAGCGCAGCTAGAGAGCTTCCTCAACAAACTGCCCGAGCCGCACACCAA