Description :
From Genome Similarity Track
Location :
Scaffold_1669:5707- 7531
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1669-fgenesh-gene-0.1Sodium/hydrogen exchanger

Sequence
1824 bases(100 bases per row)
GCTCTTTGCGTATGCGAGTTACCTGGCGGGCGAGTTTTTCCACCTGAGCGGCCACTTGGCGGTCTTCTTCAGCGGTGCGTTCATCCGACACTACCACTTG
TACAGCATTTCGCGTGCGAGCGCCACGACGTTCAAGCACCTGCTGTCCACGTTCTCGTTCCTGGCCGAGAATTTCATCTTCCTCTACTTGGGCGTGAGCC
TCTTTGCGTGTGAGTGCTGCTGCTATATTATTACCACGGTTGAATGGAACCAACTCATGCGTCTGACTGGCGACTGTGTTTGCTACAGATTCGGATACGT
TTGAGTGGGACTGGAACTTCACGCTCGTGAGCTTCGGGGTCTGTCTTGTCGCGCGAGCGCTCCTCGTTTTCCCGATCTGCTATCTCGCGAGCATGTGGCG
ACAGCGTCCTATCCCGTTTAAGTACATGGTCGTGATCTGGTTCTCGGGGCTTCGCGGCGCCATCGCGTTCGCACTGTCGCTGAATGTCAAGAATATCAGC
CATTCGAACCACGCCGCGATTATCCGCAGCTCGACGATCTTCACAATTCTGACGACGACAATTGTAAGTGTGGCTCGTTGATCGCGAAACTGGATAGAGT
TTTCATTGTCGATGTGGATGCCTTTCGTCTGTAGCTGTTCACGATGGCAACGCGGCCGCTAGTGAAGTTGCTGGGCCTGGCTCACACTTGCCACGAACAT
GCCCACGAACGCCTCCACTTGGCATGCGGTGGCCCAAAAAGGCGAGTGTGTGCATGCTTCCGTATCATTTCTTGTGATAACAATTGCTGATACGTGTGAC
CATGTACATTTGTGGATCTTCAGGACGTCCGAGTGCTCTCCGTTGTTGTCAGCGAGCTCCGAGCAAGAGGCGACATGGATTCAAGACACCTGGAACGACT
TTGACGAGCGCCACTTGCAGCCGCACTTTGGCGGCAGCACCTCGCCGCACCCAGCAGCCACCACTTCGAGCAGCGAGAAGGCATAATCTTGGAGCTTGCA
GTTGCTGGCGCTTCCAGTGTCGGCGCCATGTTCTGCAAGCTGTCATGAACTGGAAATGGCATCTTGTATGCAAGCGAGAACACAAAATGTCTGGTATGAT
GGAGCGTATGGTGCAACTGGCCGATACAGCGAAAGGATATGAATTAAAGGTATGCGCTGCTTGCTGTCGAAGCTACACTGTCCGTCAATGTAACTCAAGA
GGACACGAACCAGAACATTTACGTACGATACATGCAATAGCCCTGTGCATTGCTGACCCTTCCAGCGACATCAGCGGTCTTTCGTGGAGGTTCTTGGTGA
GTTGCAACCGACGCACGTGGCATTCGTTCACTCGGTCGAGCCACGTTGCTTCTGCCGCCACTTGTGCTCGGTCTCGAGCGCGGCCCAGAGCCTGTCCACT
CGCACCTGGATGCGCGCGATATCCTCTGGTGATCGTACCGGCGGCTTGAGCTTTCGCCGCTTGCGCTCGCGGCCGATCGACTTCGTGAGTGTGTCGAGTC
TCACGTCCGTTATCACAGCGGCCGTCGAGACGTGCATGCGGGCGTCGAATACGAGAAAGTACGCAATCTCCTTCTCCTCACTGGCGATGCGCTTGGGCTT
GCGCTTGCCAAGCGTACTGGTTGTGGCTGTGCTGGTGGCACTGGCGGCGGCTGCGTCTGGAGTCACAGGCATGGCTGAAGGTGTTGCGTTGGTGTAGCTC
TTCGTGTTAATCTCTTGGATCTGAAATATCCGAAAAAGCCCGAGAAGCGACGCCTTGCGTTATGTTTACTATATGAAAGCGCCAGTTATTAAGCAAAGTG
TGGTCACGGTTTTCAGTTTCACAC