Description :
From Genome Similarity Track
Location :
Scaffold_755:5707- 7283
Sequence
1576 bases(100 bases per row)
GGATGGAGGCCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCATCCA
AGTTGTCGACGAACAACTGTTCTTTCTAAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGGGGACCTC
TAAGAAGAGATCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTATTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGC
ACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGTCCTCCCGGGGCTCAACGATAGCACCCTCCTCCTCCTCCTCTTCTTCCT
CCTTCTCCTCCTCTTCATCCGAGGAGTCAAAGTTACTCCGATAGGAGCGAAGAGTCTCCTTCTCCTCGCGGAGTAGAGACTTAGAGGCTGTACGCTTCTA
TGAGGGCTTGGCGCCTTCGGCCTTTGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCT
TTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCGTGGGACTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCAT
CTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCTACAAAGCCCGCAGGAGCATCATGATTGCTCCCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAA
CTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGATGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAG
GAACCGATCGCCTCGGAGGCCACCTGAGTAGCATCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTCGGCTTGCGCCTTACCGGCCGCAGCCT
TGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTC
GAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAATCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGG
TCAATAAACCGAGCCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCGAAGTGTACCCTGGCTACATGAAGTGTGACACTTCACACTTCAGGAGTATG
ACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGTCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAATAGTTTG
TATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTAAATAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAGC
TGCCGTATACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAT