Description :
From Genome Similarity Track
Location :
Scaffold_12:570612- 572311
Transcript NameFunction/comments
Sapdi_VS20SDRG_04881hypothetical protein
Sapdi_VS20SDRG_04882hypothetical protein

Sequence
1699 bases(100 bases per row)
ACGCCGGCCTCCATGAGGTTGGTGCGCACGGCCGCGAGTTCGCTGCTTTCGCACATGAGCTACAGGCGGTGGCTCATGCATCTCCAATCGTCGGGCAACG
GGAGGTGTACCTGCGCCATGGTCTCGCGGTACTCGACGTCGTCGACGCCCGCTTCAATCTACAAAGACGATCAGTATGAGCAAGGACAATGGAATATGGA
GGACGGCTACCGCCAGGTTCATGACGCTCTCTTCGTCCCACGCAAAGGCGTCGTCGTCCGGCTTTTGGATCTCAAAGTACCCCTTGCGCTCAAACATCCA
GGCGACGGACCCGTTGGCGCCGAGGTTGCCGTTGTGCTTGCTCAGGATGTGGCGCAGCGCCGGCGCCGTGCGCTTCCGGTTGTCTGTGAGCGCTTCGATC
TACCTGCTATGTGATCTCCATGGCTCGAGAGGATGGACGTCTTACGATCAAGGCGCTGCCGTGGGACCCCGTGGCTTCGTACTCGACAGTCTCGGTGATG
ACACCCGACTTGCCCTCGACGCCTCGCTTGACCGCGTACTCGATCTTGTCGCGGGGCATGTTGGCCGCCTTGGCCTTGGAAATCACCGACGCCAGGCGCT
ACGCGTCACCGCATGAGAGATGAAGCGTCTCGTAGCGTTGTACAATGTTGTTGGTATCGCCCGCCGTGAGCTTGGACGTGACCATGAGCTCCTTAGCGAG
CTTCCCGAAGAGCAGCGTCCGCTTCTACAGACCGCGCAGCATGAGACGATGACCTTCGAGAGGGTGCTCGTACCGCGTCCGTGAGGCTCTTCTTGCCTTG
GATCGTCGGACCGCGGCCCATGCAGCGGCGCTGGTCAGCGCTGCCAAGCACCGAGCTCGTCGGCGCCATCGAGCGTAGGATGAAGGCCGGCTTGGTCGCG
CGCGCGAGGACTTGCAGGAGCACCATCGTCGTGCAGGCCACTCTTTCAATATGGAGATTTTGCGGTGCGTCTTGTGTCCAAAAACACGCAACCGGACCCA
CGCAACCATCTGGCGCAGCTGGGAGATATGGACCTGGAATGGCGTGGGATTAGCTGTCCTGCCAGCATGCGCTGCTGCACCTTGGACGAGCTGCTGGCGA
CGCTGCCGTCGGACCGCGAGCGACTGGAAGCGCAGATCGACCGCTTGGGCGAGCAATCGGCCGAGGTACGACGTTGCTGGCATGGACCTCTCCCACTACG
GCGTAGGCGCAAGGCTTGCGCCAGCCCATCACGTCCATGGTACTCGTGCAATCGCCCAAGAGCCTTGACGAAGGCCATATCGTCCACGTCCTCGTCGACG
ATCGGCAAAATGGCGAGATTGTGGGGTACCTCAAGACGGGTACCAAGCACCTCTACTACATGGTGCAATACCTTGCGTGGTCATGGCACGCCTCATGACC
GATCTAGACAGCTGCAGGAGCATACAAGGAGATGGACCCGGTCTGCGTCCTTGACTTTTACGTCGTCCAGCAGCGCCATGGCCACGGCGCAATGCTCTTT
CGATCGATGCTCGAGGTACACGCCATCGACGCTGTACATCAAGGCGACAGACGTCTCGTAGCGGCTCCAACTACGCGCCAAGGACCTTGCGTACGACCGG
CCGTCGCCCAAGCTCGGGCCCTTCCTCGCCAAGTACTTCGGGCTGCGCTCGTTCGTACCGCAGAGCAACCGCTTTGTGCTCTTCGACGCATATTTCGAA