Description :
From Genome Similarity Track
Location :
contig_51:57061- 58253
Transcript NameFunction/comments
g10556.t1hypothetical protein

Sequence
1192 bases(100 bases per row)
TTTTCGATCGAACGTGTCGAAGTAGTGCACGCTGTTAACGACAACGCCCAGCTTGCTTAGTTGTCGCGCAGCAATTTCATCGCGAACTTCATCGAGAGCT
TTGGTGACATAGCTTCCAAGGTAGTACTCTTTGACCGGGATAGCACTGATACCAACCAGGACGAGCACGAAGATAGCGACACACGTTCTGTAAGAAACCT
CGAAGTCGCGGAATGCTTGTAATCGCGTCACGAATCGTGTGGTTCTGCTGTTATTGTTTGAGGGTGGCGTCGGGCCATGGGTTGCGCCGCTTTTCCTCGT
CATCACGGGTCAAGAATCTAGCACAATAAAGTGGAGTGGGTAGCTCGCCCGAAATGGTCAACTTGACAAGTCAAGTATAATTAGCGGGTTGGTAAAATGA
CGTTTGTGTTAAGCTTCAACATCTCTCGTCTCGAGTTTCTTACTTTTCTTAGCGGCTGGCGATACAATTCTCCCCTCAAGTTACATTTCATTAGCTCAGT
GAGCTACTCTTCATCTTGTGAAAAACCGAGGAGGCAAGGGAGTGCTTACGTTCACCCAAACTGCTGGCCGTTGTGAAACTGGAGCCATAGCTCGATGAGG
ATGAAAGGTAATAGTCAGACGGTGATGATGAGGCTGAACGAAGCGATGGGTGCCCTGGCGGTGGTGGAGTTGTAAGGCTAGCACTTTTTGTCGGAGACAA
CGTAGAGACCATCGTCGGCGCGCTGGATGAAGACGCCGCCAATTCGCAACTCTTGCGGCGCTTCTGAACGCACCCAATGCACACGCGCACACTTGTAGAA
CCCACGTCGGGGAGCGCAACATCCATTTTCGGGCAGCACTCAGAACAGCAGATCTCACCGCACAAACGGCAGTGGTGACGACGACGCGAAAGACCAAATT
TTGCATCACAAATACGGCAACCTAGACGCTCACGATTGTGCACCCAGTGAGGCGCATTCACGAGGAGTGACTGTGATAAGCGTCGGCTTGTGAGCACCTC
CTCCAGTCGTGCAATCCTGGCGCAGAGTGCCCGAAGCTTTGCTCGCCGAGACGCCATCGGCAATTGTGCTTTCTCCAAAATCGAAGCCACAAATTGTACC
TCTACGTAGCCGTCACGACCGCGAGCCTCGCGAACCATGAAACCTGTAGGCTGGAGGTCCGTTGGTTTGGAGCCAACCTCGTCCAGCCACGG