Description :
From Genome Similarity Track
Location :
contig_15:570568- 571867
Transcript NameFunction/comments
g4283.t1hypothetical protein

Sequence
1299 bases(100 bases per row)
GTTGCTAGGGAACGAGATGTTCCTCCAGTCGATCCCCTCGGCCATGTACACCTGTTGCTCGCGCACGAAGACGAACTCGTTGAACTGCGCCTGCAGCCGC
TCGTTCGCGTAGTTGATGCACAGCTGCTCGAACCCGTTGCGGTTCAAGCTCTCGAACCCGAAAATATCCAAAATCCCGATAGTCGCCAGCTCCTCGTCCT
CGTCCGAGATCGAAATATCCGAATCGTAATAATTGATCTCGTCACTCAGCCGACGCACGAGCCACGTGAACAGCCGCCCGTAGATGGATTTGGCCAGAGA
CCCGCAAATCTCCTTGGCCTGCTCCGGGTTCAACTTCAGCACCATCACCTCCATACCAGCTTTAATCTCCCGACTGCTCAGAATCGTCTCCAGTTCGTGT
ACATCCACGCCCAGGAGTTCGGCACATTTCTGCAAGTGAAACTTCGAGTCCGCTTTAACCGCAGTCACCTCCTCTTGGCCCTCAAAATTGACGTTGCCAA
GGTGCAACAGGGCCGCTAAAATCTTGAAAATATCCAGCTTTTCTCGTTCCCCGACCCCCGTATCTTCAAAAGCCCTGACCGTCTCCACGTACAATTGCGC
GTATTTGTCGGCCACTGCTCGTTTTTGCGCAAAACTCGGTCCGTACGAGTTGAGCAGCTCGTATTTGCCTCCTTTTTGCAGCCCCAGCGAGTGCAACAGC
TCCGCGTCCGCTCCTTCGAGCAGCTCATAGAAAATATGGAAGCTGCGCTCCTCTGGGTTTTGGTGCAAAAGCCGCACCTTCTCCAGCAGGTAGCTCACAA
TTTGCGCGCCAACGATCTCGTTCTTGTCCCCGAACTGGATTTTGATGAACTTGCCGAAGCGACTGGAATTGTCGTTGCGGATCGTTTGCGCGTTGCCGAA
ACTCTCGAGGATCGGGTTGGTCTGCAAAATGCGGCGCCCGATTTCGGTGTCCAGTGACGGGTCGCGCCCCACGTTGGTCAGGAATTGCATGAGGAATTTC
GTGCTCTCGGTTTTGCCGCTGCCACTCTCGCCGCTGACCAAGATGCTCTGATTTCTTCGCTCTTTGCGCAAAAGCCCGCCGAACGCTTTTGCACCAATTG
CGAAAATGTGCGGGGAAAGTCTCTCTGCCGCGCCGAAATCTTGTTTGTAGGCGTCCAATTGCGCCTGCGAATAGAGGTTCGGCAGCGGCTTAAGCGGGTT
GAGCGCAACTAAAATGTCGCCGATAGACGTGTAGATCTGATCTTGCGCGAAACGCTCGCTCAGCGCCTGCAAAAGCGCGGCCTCGTGTAAATGCTCGAG