Description :
From Genome Similarity Track
Location :
Scaffold_675:5705- 8346
Transcript NameFunction/comments
Phymu_g11499bifunctional aspartokinase/homoserine dehydrogenase, putative

Sequence
2641 bases(100 bases per row)
CGCGTGCGCCGCAATTCCGTGCCAGGAACAACGTACTGCCGAAAAGCGAGCCTGCCGTGATCGAGCAGTCTGCAATGGGGCCAGTAACCACTACGGGGTG
CAGTGAATGCCGCAGCGTGTAGAAGGCAAAACCACCCTGACGGCCCTTTAGTGAAGCAAAGGAGTGCGTCGGCGGCAAAGCCTCCACCCGGACGGAGATC
TTGCCCGTAGCGGCGTCGATGTAGCTCATCTggcgcagctgcagcgcctgcttAGGGTCCGCAGCAGCCTTCGCGATCTGTTCCTTCAGTGGGGCACTTG
CTTTCACGAGGTGCTCAAGCAAGTAGTCGTAGCTCCAGGCGCCGACCTCGTCCTGACTGCCGGCAACTGTAGCGCTGGGGTCCCACGGGCTCTCGATGTC
GGCGTCCTTCAGCTCGATGTCGTAGCCCATTTCGCGAGCGATCAtgatcgccttcttggcgctGCGTACGCccatgacgtcgtccacgatgtCACGCACG
CTGAACTCATTCTTGTACTCCGCCATGAGGTCCTTCATGATCGCTTCCAGGTCGGCCTTGGCCGGCTCAGGAAGGACAAACACAGTGTCGAACATGGCGT
GCAAGAAGCGGCTTCCCGAGTACTCGACGCGCTGGATGTCGTCGCCCGTCTGGATGAAGTTTTGGATCGTGTTGAAAATGGGAACGCCGATAGCCAGCGT
AGCCTCCGGGTCGTACGTGAGCTCGTTCTGAATGGCCATCTCCTGCATCGCGttgtgcagctccgtcgaCGCTGACGACACGTTAATGTTAGACGTCATC
ACGTGCACCTTGCGCGCTAGCCACTGCGGGTACAGGTCTTTCACGTGGTGAAAGCTGTTCGAAACGTCAATAATGAGCCAGTGGGGAAGGTGGTCCGCGC
ACACGTGATCCAGGAATTTGTTGCGGTCGAACGGCACGAATTCGTTCTTCCGGCTGGCCAAAGCCTCCTCCGTGATGTCGCCGTCGACGTCCAGAAGCAT
CTGCGAGGAAATGTGAGTGCCGATGGCGCGCACACGGATAtccacgttgaagcgctgcttcaggaactcgcgctgctggtggtaCTGCTTCAGTAGAGCG
ACCCCAATGCTGTTGgtctcgtcttcttcaaacTCGAGGCCCATAAGACCGATGGAAAGCGTCTGGTCCGACAGGAAGAACGAAGAGTGCACCGCgcgca
gagcagcagccgagtCCTTGTAGTGAACCACAGCGGAGATGTTGCGCTCAGACGACCCCTGAGAGATAGCCAGCACGTTGATCTTCGCGCGGCCGAGTGC
GCCGAAGAAGCGGGCGCATACACCCGGAGTCTGGTTCATCTGGTCgcccacagcagcaatgaTACTGATCGGCGCAATGTACTCCGCCTTGTCAATGTGT
CCGACGTGGATCTCCTTGAAGAACGTCTCGTTGATCACGTCCTTCGCCACTTCAGCGCAGTCCATCGGCACCGCGAAACAGATCGAGTGCTCCGAGCTGG
CCTGGGCAATCAGCACAACGTTCACCTTAACGCGGTCCAGCGCACTGAATAGCCGAGACGACGTGCCGTGCACGCCCACCATGCCGCTGCCTTCAATGTT
AAACAGCGCCAAGTCATCGACAGTAGAGAATCCGCTCACGATGTTGCGCGCCGTGGGAGTGCCGTTCGACATggtgcgcttgagctccactTTCTTGCGG
TCCCAGATCTTCGTGCCTGGGTGTTCCGGCTCGAACGTGTTGCGAATGTAGATAGGGATGCCCTCAACAATAGCAGGCGCCATGGTCTTCGGATGGATGA
CCTTAGCGCCAAAGTACGCGAGCTCCATGGCTTCCTGGTACGATATCTCAGGCAAGATCTGCGACTCTGGCACACGACGAGGGTCAGCGCTCAGCACACC
ACTCACATCCGTCCAAATGGTTACACTGTTGGCATGCAGCACGCGGCCGCAGATCGAGGCGGTGAAGTCGCTTCCGTCACGTTTAAGTGTGGTCATGACG
CCCTCGACTGTGCTGCAAATGAAACCAGTGACAACCAAGTGCGTGAGCTTGTCACCCCCTGCATTCCCCAGGATCGcgttcatcttctgctcGGACAGGT
CGTACTGCACTACCGGTCCGTGTTCATTGTCAGGCTCAACCGTCAGGAAATCGCGGGCGTCCACGAAGCGGAAGGCGTGCTTCTTGCCGTCTTGCTGCAC
CTTCTCGCTGAGCACAGCTGTGAGGATCTTGGCCGACCAGATCTCGCCGTGACCGGAGATAAACTCCACAACGTTGTCGTTGTAGGCCTGCatgatggag
atggagcgcaACAGCTCCGACACGGACTGTAGATCGCGCGCAATCGCCTTTTCAATGGGCTCTCCCACCTCCGGGGGCAACAATGCGCTCACCACATCGT
GGTGTTTCTTGCGTAGAGTGTCGAGGATCTCGTCGCACTCGACGGtgcggcgctgcttggccaGCTCAAGCAGTGAGATGAGCAGATCGGTCACCTTGGG
TTTGCCACCAATAGCGGACACCACTACGGCCACGCGCGGGGCCTCAATCGCCGACACGATGTCCGCCACCTTGGCGAAGCAGTCGGCGCTGCCCACGGAC
GTGCCGCCGAACTTATGCACCACGAACTTGTCTGCCATTCT