Description :
From Genome Similarity Track
Location :
Scaffold_1:5704040- 5708719
Transcript NameFunction/comments
Physo_345421glycoside hydrolase putative
Physo_310783cell division protein ftsZ

Sequence
4679 bases(100 bases per row)
GAGGCGCGACTTGTTCTTTTTTGTGAGGCCGATCACATCGTGTGCACGTGCGAGGCGGACGTTCCCTATGCTGCAGTATCGTGGGACGCGCCAGCGCTCC
TGGCTCCACCAAGCTTCCGATCTCGAGCTCGGCTCGTAGACTTCGAGCAGCGCTCAACGCTCGACGCTCGACGCTCGACGAGCACATGACCCCCGGCGGC
AAGTGCAAGGCGGTTGCAAGCTTGCGGCCTTCGCCTTGTAGCCGGTCGGCACAGTCTGAGCTCCGTCCTTCTCGCGCAGCAGGCCTGCAAGCCTGACAGT
GCAGGATATTAGCGCTGGTTTCTGAAGCAAAGCATGCTTGCAGTTTCAAAGAGTAACGTGGGCGTCCTGCGTTGCAGAACGGTTGTTGCCTGTCTGATCT
GCGAGGCTGAACTAACGCCGTGAGTGCCCTGGCCAACTTGTATCAGCGGCGCAGCTGGTGAGCCCCAGGGCCGAGCTCCGAAACCACACACGGGTCCAGG
TGGTTGCAGCCTTCGGTGGCCCAGCCTGGCGTAACTCGGTCGTGGCGACGCAAACGGGCCACGGCGGATATCGCACACGGTCGCATATCGGGCGGGCACA
CCATCCAGCCAGAGCCCGCTATCCAGCGTCCCCACGTGCTGCAGTCGGTATTTCCAGCCCACCACCCCACGTCACTCCCCGGAGCCGACGTACACAACCC
CGCGCGCTGCAGCAGCCAACTCCAGCCTGCCCTGCACGTTGTACCATATCCCCGCGCTGCGACGCCTGTCCAAACGGCGGAGAGCAAGGCGACGAAGGCC
CCCCCCCCCCATCGGCGAGCAGTGCGCCATTTAACGTAGCGTAGCGCAGGGATCCGGACGAGTGCAGTAGTCGAACATGAACTTCCAGAGCGGGGTGCAG
GTGTTCATCCCGGCGGCGCTCAACAGGCCAACGCACACGCTCTACAGCATCTGCATGCTGGTACAGCCCACGAACCAGGAGTGGACAGTCAACCGCCGCT
ACTCGCAGTTCCTGCAGCTTCGGAAGGACATCCAACACAAACTCGGCACGCGCGGCGTCTCGTGCGCGAACTGCGCCAGCTTCAACCGCGCCATCAGCAA
GTTCCGCTTCCCGGGAAAGTCGCTGATGCGGACCAACTCGGTGGTGCGCCACCGCGTGTCAGCGCTCCAAGACTTCCTCAAGCTGCTCGTGGGGCGCACC
TACAACGATCTCCCCAAGTGCGGCATCTGCGGCGATGAGATTAAGGACTTGATGCGGCCGTTCCTCATCCGAGGAGCACAGCCGATGAACGGGTCCATCC
TGCCCAAGATCAACAAGTCGCTGTCGTTGGAGTCGTACGCCGTGGTGGAGCAGCCGGTGATGCCCGTCCCGGAACCGGCGCCGCCCATTTCGCCCTCGTT
GATGGGCCGGGAGCTCTTCAGCGCCAGCAAGTCGTCGAGCAGGCCCATTTTCACTCAAAGTCAGATTTCAGGCGGCAAGTCCATCTTCTCGCGCAGTAAG
GCGATGATGAGTACGCGGTCGGACGATGCGTCCACACAGCCGAACGAATCCGAAGACCCCATTATGGACTACTCGGACAGCGACGACGACGGCTACGGCA
AGAAATATGATGATCAGCGCTGCTACGATGAGGGCGTACCGCTCGAAGAAGCGATGAAGCAGGTGGTGGTGCCCAAGGGAACTCGTCTCACGTGCGAAGA
AGTTGTTGTCCGGCTCACATCCATGTGGGCGTCTTACGACCTGGATGAGGCGCTTTCATCCTTGCCGCCCGAACGTCTTTCGCAACAAGCCTTTTTCTCT
GTCGACGATAAGGAATACGCGTTCTAGGTGTGGCGTTGATAGTGCAATTTTGCTTTCCGCCTCTTGGGGTAGCTGCTAAGCCGGCCAACAGTGCCGCATC
GCCCCACAGGAAGGGCGTTGTGCAAACTAAATATGAAGCAGTCAAGTATAATATCAATGCGATCAGCATGGGTTGCCATCATCAACCTTCTTCTTTTCAT
CTTCTTGTGGTTACTAATCGCCAATCAAGACGAAAACAAAAGGAACGAAGAATCACTAGGTATCGTTGTCGGTTGATTCTCCATGCTCGCTTGTCGAACA
TGCTCCAACACAAGTTCACCATCTATAACTTCTCCGGGTCAGCGATGCCCGTAGCGACAACGGAGACGCGCAGCTTGCCATCCAGCGAGTCATCGAACGT
CGAGCCGAAGATAATGTTGGCGTGAGGGTCGTCCAGTTCCCTCGTCACCCTCTCCGCAGCTTCGTCGACTTCAAACAGCGTCAGATCGGAGCCTCCAGTG
ATATTTACGATCATGCCCTTGGCGTCCTGCGCGTTGCGAAAGAAAGAAAGCATGAATAAGATACTCGTTAACACAAACATAATAAGAGTTACCAAACTTA
AGTGGTGGAAATCAGTGTGTACCTTGATCGAAATATCTCCTAGAAGAGGGTTCGCCAACGCATCCTCAGCTGCACGCTGCGCCCTACAAGCGACCGCAAA
CACAAGACCAGTTAGCCTATCGTCTCACCTGCCTATAATCGTCGATAACAGCCAGACGCACCGGTTCTCTCCATCGGCCTCTCCACTTCCCATCATGGCG
TTTCCCATATTTTGCATCACCTGCGGTTACAACGATCGCCATGCGAAGTTAGCAGGGATACCGCCCAACGGACAAAGACAAATTTACGTACCGACTGAAC
ATCCGCGAAGTCGAGGTTAATGAGACCAGGCATCACCATCAAATCAGAGATATTCTTGACGCCGTCTAGGAGCACGTTGTCCGCCATCCTGCATTAAAGA
AACAAGCATCGTTAGAATTACTCAGCATCGATACCTCCTCAACCAAAACCGCGCACCGGAAAGCATCCATCAACGACGTCCGCTCGTTCGACATATTGAA
CAAGTTTTGGTTCGGAATCACCAGCATTGTGTCCACGCTATCCTTCAGCTCAGCGAGGCCCTGTGCTGCCAGCTTCGCACGGTTGTTGCCTTCAAAGCGG
AACGGCTGCAATGTGTGATAATAAATCGGGATGTTAGTGCATGATGCTAATTGAATCGCAACGCATCCCCGCTACACACCTTCGTGACGACTGCCACCGT
GAGAATACCTGCGTCAAGAGCTGCCTGAGCAATGACAGGAGCTGCACCTGTGCCAGTTCCGCCGCCCATGCCTGCAGTCACAAACATCTGCACACAGATA
GAGATAGTGGCGTAAGCAGCTACTTGGTCCACCACCAGCTTTACTTGAAAAGTCAACGCAACGAACCATGTTTGCACCTTGAACGCGTTCTAGAATCTCA
TCGATCGACGCGTCCGCTGCTTCACGGCTGGATTAACACGACGGAAAACAAAACGCTTAGTCTAACTGATACCCTTTGATAATCCAACACCCTGTGATAG
CCGTAGCCCGAACACGCACCCAACTTCGGGGTTGGCGCCACACCCCAGACCTCCTGTCAGCTCAGGGGCCATCTGAACGCGGTTCTCCGTCAAGGTCGTA
CGCAAGTGCTGTGCATCCGTATTGCACACCAGGAACTCGACGCCCTGCAGGCCGCGCGCGATCATGTTGTTCACTGTCCATGAAAGTCCATAACTGGTTA
GAGACTTTGGCCAGCTTGCAGCATTAGCCATTTCTATCGGTCTATACGAAGCTTCTTACCAGCATTTCCTCCAGCTCCGCCCACACCAACGACCACAATC
TTGGGCGCGAAGGCTGACAAGTCCGTCACGGGGTGGTCCTGCGTGAGCCATAAGGGCTGCGAGGAGCTTACGGCCGGCGGCACAAGCTTCTTCTCCACTA
CTGGAGGCGCCACCGCGCTCACATCGGTTGGCGACACAGGCTCTGCCTCCTCCTCCACCTTGAGCGCGTCGTTTTCGTCCTTTTGAGCCTTCTTGAAGCC
CTATCAATCCATTGACGCGCAAACATTCGAGCTCAGAGCCTACAACACGGCGCTTTCCACAGAGACAGCGCGCAAATTACCATGCGCAACGCAGCGGCAG
CCGCGTCGGTAGCTTCGGTGGAGAAGGCGAGGCGCTGGGTGGCAGCCTGGTTGCTGTGGCGCACGCGCAGCAGCGCCGTCACCGCTGCCTTCATCATCGA
ATCGGAACTGGATCGCCACAAATGAAGTATGATTTTCTATTGTGAATTTCACGTTTCGGGGGGAAATTTATGTAGCCATGTCTTGTTCCTGCCTGCGCAG
CTCGTCCACGTTAGCCTTGATGTAAAGCAGCACCTCCGCCTCGGTCAGGTCCAACTGCACGCCGTAGTTTCGTCCTACAAAGGTGCTGAAGGTGTCCACG
TCTGAGCACAGCAGTCGACCCGTGTCGGTCCAGATGGCGACGTCGCTGATCACGAGGTTTGACGAAGTGGGCAAGTTGAAGCTGTTTCGAGCCACATGCA
ATGTTTGTTATCCAATCCTCTCATCGACGACAATAGCTTGTGCGGGTCTTACCCGTGCAACCTCATCAGCTCAGCAGCGTCGTTGGGCCAGCGGTCGGTC
CTTGATGGGCGTTTGGTTACCTGGCAATCGGGCAAAACCGCGGCCAGGATGTCTGCAAAAGCGAACCGGGTTAACAGATTGAAGCGGGTAGTGCAAGGAG
AGACTATCGTACCAAGTAGGCGGTCGCAGATAGCGTACTCCTCGCTGCTCACGCGCCCAGCCAGTGTGTAGTGAACCAT