Description :
From Genome Similarity Track
Location :
Scaffold_57:57037- 62271
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014022Similar to ftsjd2: FtsJ methyltransferase domain-containing protein 2 (Danio rerio)
Pytul_DAOMBR144PYU1_G014021Similar to mtmr2: Myotubularin-related protein 2 (Danio rerio)

Sequence
5234 bases(100 bases per row)
GCGACGAGGTAGCGCTCTGAGCTTGCTGGACGGCTGGTCTAAAAATGCAAGGACGCAGAAAATGGTCATTTGCGCAGCTAGGTTTTCCTCATTCTCGTGC
GAATGTGATGCACCACTTACGATTGGCTTGATGATCGCAATCTTCTCGAAACATTGATGCAAAAGCCATACGAGCTGCAGCAGCATCGGCGTTGTGATCT
CAAACGTCTTGCATAGGAAGCTGCCATGAACCTTCAAGATGGACAGCATCGTCAGGATCTCAGCCAGGATCAACTTTGTCATCATCTCTTCCTGGTTTGG
CTGATCTCTGGCGTCTTGGAAGCCTCCATCGGAAACGACCAGGTCGACCCCCTCAGCGTGATTCTCCCGCACCAATTTGCGAAAATGGCGAATGTTGTCG
ACAGAGTACAGGTTCCCCGTGCCATCTTCTCCGTACGAGATCTCAAAAGAGGCGTTGGGGTTATCGAGCGGCGGTAGTTTCCAATCGCAGATCTCATCTT
TGAGAGAGATGCCGTACCCTCGCACTCGTACTCCTCCCGTCAGCTTTGAGTGCTTCCACAAGAGATACTCGGAAAAGCCACCGGGGCCGCCACAGACATC
CGCAAATGTGAACACTGGCGACGCTGAAGCATCTGGGTAGTCCGCAGGGCGTGCCGTCCACTGGAAAATATGGTCCATGTTGGCCAGCTTCATCGCCGAG
CGGTTGAGAAAGCGGCTCCGTCCAAGGGATTCGTACGGATTGGCTGCACTTCGCGCACGACGGAACACGGTGTTGTCGAGTTCATCAAACCTGGCGAACA
CGAATTCCGACAAGCACAGCCCACACAGTTAAATACCCAGTGTGCCAATACTAAACGGAAAAAAGGCGGCCATACCGGTTCTTTTGCTCTTGTAGCTCAT
CAAGACGCTGGTAGCAACTTGGAGGGAGCAGTCTCGCCTCCAGGGCATTGGCGTCCTTGTCAGCTCCAGAAGCCGAGCTCCATGCGCTTAGTAGCTCATC
CAGTGGCTTAAGGCCATCACCATTGCTCGCATTTCCGTCAGACTGCGTTGACGATTTGGTCTCGTTGGCGAGGAGCGTCACGCCTTGCGGTCCTTGTTCG
AGTCTCCCACGGCCATGGAGCTGCTCGGGCACCTCTGTGCCTGGGATCACTTGCGCGAGCCGCGCATGCTGCGATGACGCCGATGCGCTGTGTGAAAGAC
CGTCACGGTGGTGCACCCGCTTGTCCTGTCGTTGTCTGCGTCGAGCGCGCTGCGCGCCAAAGGATGCGAACCCCATGAGCGCCTCCATGTCATCGTCTGC
CGCCATCTCGCAAAGAGTGCCCAATTTTGGTTCGTGGCCGCGGGAAAAAGGGGATATATGCTGAGAGAAAGTGCATATCACCCTTTTGCAAAGGAAGGAT
CATGTAACTAGACTCTGGCAGCGAAAATGAGCACGTTGTTCGGTGGTGTGTATATTGTACGAATCTATCTCTCCAAAGCAGCTACGACCTAAAACGCCTT
GTATGCATTTCACGCAACCATTCATGTTCTTCTTTTGTGGGTTTCTCTCTCTCGTTGGGTTCTTCTGCGCGTCTCCATATCAGCTAGTCAGTCGCGGGTC
TGTTTGTCTGTTGGACCTGCATTACTTACCCTCCCGCATGGCTTCCGTTTCGCGTGGTGCGCTGCATTGTCACGCGGTGGTGGATCGAGTCGAGCTCTGC
TTCTAGTTGGAGCTCACGCGCCACACTCTCGCTGAGCAGCTGCTCGAGGTACTTGATGCGACTTTGATCGGGCGCCATCTGCAGCGCCTCGCGGATACTT
CGACCCTGAGCGCGTTGACGCGTGCGTTCCTCGGCCCCGCGGCGATACCGATCAACGACTTCGTCGTCAAAATCGTATTGCGTGGATGTCGCGGCAGATC
GCATGAAATCCGATGATGGTGTCTCGTTCAGCGAGACTGTTGATGCCGAATACATACCAGAGACACTGGGCGAATCTGCAAAGTTTTCCTCATCATCACT
CATGTCGGAACAGTCCGAGAGCTCCATCCGGTGCCGGAAGTCGTCATGGTAGTCGTGGATCACGTCAATGTCGAGTCGCAGCGCCTTCTCTTCGTCGTCT
AGATCCGCTGCCACCATCGGTCCGAGCGATGGTGAGGTCGCCACAGTCCTGTTGCCGCCTTCGCCATCTTGGGGTGAATCCATGTACTCCATATAATCCG
GATGGCTCTCAGGGTCCCAGCGGAAAAACATCGCGTCCCACAGCACCACTCGCTTCAGGTTCGCACGCGGGTACAGCACGCGATTCGTGGACCGATACAG
CGGGTTCTTGTACGGCGTCGGGTTCTCCAGCACCGGCGTCCACACCGACTCGGTTCGCTCCCACACCTTGTCGAGAAGGCGTTCACGCTCCGAGTTGTAC
AGGAACGTGCCGTACAAACCAGAGAGCAGCGCGTCCGAAATGTGCAACAAAAACTTCTCGTTGAACTCGAAGCACGTCGGAAACTGGCGCGTCATCTGCC
ACACACAATCCAGGAACTGCAGCATGACTGGGGATCGTTCATTCGGGTTTTCCGAGATATCTTTACCGATACCCACGCGGTCTGCAAACTTGTGACCGAA
CGAGCACCACTCTTTCTCGATCAGGCACGCAAAGCCTCGAATCGTACGGTAGTACGGGTCCAGGATCAGCTGCGCGAGCGCGACCAGTTGCGGCGTACGA
TCCCAGCCGTCACTGCAGTGCACGAGCACAGACGCACCATCTTCATGCAGCACTTCGGCAACACGTCTAGCTCCGGACAACACACGCATGACATGCTTCA
ACCACCTTGTGTCTGTTAAAAAGAAGAAAAAAAGTCAACCAGTTAGAAAACACAATCATCCCAGTCGCCGAAAAAAAAAGAACGTACTTTCTAAACGATG
GTGGTAGTTCTTGTCGCCATCTTCTACACTACTTGGACTAACCAGGGCTACAAGGAGCACACACATATTTTACAAGTTAGTAAAGCCCACACAGACATAA
GCGATATCATAAATCACGCACTTTTCAACGCATCAAGCGACTCGCGCATCTTGTGGATATTTGCAATCCCCATGAACTCAATCGCCGCGTTGTCATAATT
CTGTGAGTTCTCCACACCTAAACACAAAAATACGATCAGTTGTCGAACACAATGATATCAGTTCCGTTTTGTCCAAGGCCACACACACAATCGCGTACAC
GCATATACCTTTCCCTTTTAACCGGTTGCCTTTTGTCGCAATCGGCTTTCGCGCATCGATGATGTGCAGAGGCGGCGCCTCGTTCTTACTATTCTTGTTG
GCCGAGTCTCGGTACGCGCGCAGCAGAATGCGATCCGGCTCGGATTTGTTGCCTGCCATGCCGTAGTTCGGTTGGCTCGAGCGCGCCAAGATGCTGTGGT
TCACCGGGTGGCGCCACACGGCCACGGGCAGACGCGCGCGCGATCGGAACCGCGCTGACTGCACGAGCTGGTCTTCCGTCATGATCGACGGCACGATCAT
CGTCTGCGGGTACGTTGGACTGAAGCGGAACTTGTAGTTCTTGAGTATTCTCCAGGACGTCGTCGGTGGATCCGTTTGGCCTTCCACGCGGCTCTCGCGA
TCCATTCTCCCGCGCTCGCCGCTGCTGCGCAGGAAGCCTAGACGCGTGTACTCGGTGTTCGGCGAGTAGAGAAACCAGCCGTTGTTTTTCGGGTTCGGCG
GCCCCTTCAGCCGGATCTTCTCCGTGTGGTAGTCGAACGCGAACAGCGTGTCGATCGTGCTTGGGGGTTTCATGCGCAGCGTGAGCAGGTTGATCCACCG
GAAATCGGGCGTCGTCGGCAGCTGGTCGTACCCTTTCTTGCGCGAGTACGCGTCGTGCATCGCGAGCCGCAGCGTGCGCAGGTCCTTGCACGCGATCAGG
AGCATCAGTCCGTCACGGGTGATCATGTCGATCGTCGCGAGTGGTACTTCAAACGAGCCAAACTTCCACGACGCGTCGTACGGCGTGAACGTGATGCGGT
ACGTCGTGATCTTGAGCACGCCCTGCACAGCGCGATCGCTTTGCGACATCACCACGAGGTTCGTCACGCGCTGCACGTGCTCGAGCACGTTCTCTCCAGG
GAGCAGCGTAAAGTTGTCGGTCACAATCGAGTCGCGGAACTTCGTGCGCATCAAATCCGTCGAGCTCGTCGACACAAACGATTCCTCGAGCGTGGCTTCC
GTGTTGGTGCGCGGTGGCGGCTGCACCGATTTCTTGTACATGACCTTGCCTTCTTCGAGCGCCTGCAGAAAATTCGCACGGTCTTCCGTGCTGAAAAACG
TGATCTTCTTGGTCAGCGACGCATTGCCCGTCTGGATTTTGAGTTGCATGCCCAAACGCGACTGCGGACGCGCCGTCACGGCGGCGCACGAGTAGCTCTC
GCGGTTGTCATGCGGCGATAGGAAGTTGAGCATGCGCGCCTCAATATCGACCTGCAGCTGAATGGACGCCTTCTTGCTGCCGAGCTTCTCGAGCACGCTG
TCGGACTTCTTGACCGTGAACGTGAACAGCGTAACCTCGGAGCGCGGCGGCATGTCGCGGTTGAACCCGAAAATGTTGTGCGAACTGCGGCTGCGGCCGT
TCTCGGCCATGAAATTTGTCTCCTGGAACGGGTCCACGGCCGTCTTGAGGCCAAACGAGAGCGGTTTCTCGTAAATATTGGACGACGACCCGGGGTACGC
GCCGAGGGACGATCGTCCGCCATCGGGTCGCGGGATCTCGATTGGGTATTTCGGAGATGACGACAGCATGTTCGGTATGGACGATGTCACGGCGGCGCCG
TTGCCTGCGTCCACGAGCCGCGCCATCGGGATCGCGTGCGTGCCACCTTGATGCGAGCTATTTTGGCTCGTGCTGAACGGCGAGAGACCCGACGACGAGA
GCGACGCCAAGCCGCCGCCGCCACTGCCGCCTGTGCTCGTGGTGTTCGCCGTGGTGGCTGTCGACGACGCCACGGACGGCGGCGACGACTGCATGTTAAC
GTGATCGTTCTCCTCGCCACCAAAGTCGGCGTTCGAGACCGTGCTGCGCGTCTGGTCCTGTCGGTTGATGATCTCCCAGGCGCCCTTGGTGGCCTGGTCG
GCCTCGTGCAGGTGCTTCTCGACCATCAGGAGCTTGTCGAGCGTGGCCGAGTCCATGGTCGACTGGCGCTGCGCAAAGTACGCGTCGTCGCCGGGCTTCT
TCTTGCTGCTCTTGTTGTCCGCGGCGGCGCTGCG