Description :
From Genome Similarity Track
Location :
Scaffold_80:57035- 59132
Transcript NameFunction/comments
Physo_139928hypothetical protein

Sequence
2097 bases(100 bases per row)
TCCCCACGCAGCCCCAACATTCTGTGTCCGGAAACCAGTTGGCTGGAGAATTGTTCACGACTACCGGTACTTGAATTCGAACACCGTGCGTCAAAGTATC
CCGATGACGAGGAAGGGAGACATCCTTGACGCCATGTCCGGTGCGTACTGGTTCTCCACGATGGACCTGATGTCCGCGTACTACCAAGTGCGCATGCGGG
AAGAAGACATCAAGTTTACCGCATTCCAAGCGCCGAACGGTCTCTGGGAGTATCTCGTTCTTCCAATGCGAGTTTGCAACGCGCCAGCAACGATGCACAG
ATTGACATCGAAGCTCTATCGAGACTTGAAGAACACGAAGTCGTTCTACGATGAATCTATGTTTTCACCAAGTCACCGAAGATCGAGGACCATCTGAACG
CACTGCGGAAAACACTTGACATCTTGCGTGATAACAAGTTGTACGTCAAGCTGTCCAAGTGTGTCTTCTGCTCCGACGAGATCCCGTGTCTCGGAGATTT
CGTAGGGCGAAATGGAGTTCGGATGGATCCAGACAAGGTGCAGACCATCAAGGACTGGCCTGTACCACGGACGCAAGAAGAGCTTCACAGCTTCCTTGGC
TTGACAGGTTACGTCCAGCGATTCTGTCCAGAGTACGCATCTCTGACAGCCTCCATGTTTGCGCTCTTGAAGAAGAAGAACAAGCGGAACGCCAAGATTC
ATCTCAGCGACGAGCAGCTGAAGAACTTCAAGGAGTTGATGCGGCGACTGTGCAACCCGCCAGTATTGCACTTGCCGGATTTCAGCAGCCCCATGCATCT
GCGTACCGAGGCAAGCAAGTTTGCTGTCGGTGGAGTCCTTTTTCAAGTGGTGGACAGAGTTGAGCGCCCGATAGCGTACACAAGCCGGAAGATGAAGTCG
GCAGAGCTCAACTATCTGGCTCAGCAGCAGGAGCTACTAGCGATCGTTCATGCGCTGGCAGCGTTTCGGATCTACTGCCTGGACAAACCACCCATCGTCG
AGACAGATCACAAAAGTCTCGAAGGACTGTTCACCCAGAAGATGGCCAACCGTCGACTCGCTCGCTGGTACGACATCCTTGCGGAATACCAGCCGACGTT
CCCGTACCTTCCCGGTGCGAAGAATGGCATCGCAGACGCGTTAAGTCGAAGGTCAGACTTACAACCGGAGACGAAGTTCTTCCACGACTTACGGGTGACC
AGCTTCGACGACACATCCTTCAGCCTCGCGATCAGCGAAGTAACGGGTGACTCGGAGCTGATTACGCGCATCAAGAAAGCGTACAAGAAAGATCGTGATG
TCCAAGCAATCTTGACAGCAATCAAGCGACGCAAATCCGACTCAAAACCAAAGCGCGAACACCAGCAGCACAAGAAATACCGCTGCTACTCCGAAGCGAA
CGGGTTACTGTGGTATCAAACGCCTGCAGATGACGCTCCACGGATTGTCGTGCCCAACGATGTGAAGTTGCGACAGACAATTATCAGCGAGTGTCACGAC
ACCAACTACGGAGGCCATCCCGGTGCGGAACGTACGTACTTGACACTGGCGCGCCATTGGTACTGGCCAAAGATGTTGAAGTCCATCCAGAAGTTTGTCG
CCGACTGCGAGCCTTGTCGGAGGAACAAGCCGCGGTTGACGAAACCTCCTGGGTTGCTCGAGCCACTCAGTATTCCAGACGAGCGTTGGAGATCCATCTC
CATGGACTTCATCACTGATCTGCCGCGAACGGAGCGGGGCATCGACTCTATCTGGGTCGTCGTCGATCGGTTGACCAAGCGGTGTCATTTCGTGCCAATC
ACCAAGAAGGTGAACGCCGAAGGTGTTGCTCGACTCTTCATCGACAACATCTGGAAGTTACACGGCATGCCGACGAATATCGTCTCCGACCGCGACAGGA
AGTTCGTGTCCGCCTTCTGGCAGCATGTCTTCAAGTCCATCGGGACGAAGCTAAGCATGACCGTTGCACATCGCGCTCAAGGTGACGGACAAACGGAGCG
CATGAACCGAACCTTGGAAGAGTATCTTCGGTGCTTCGTCGGTCCACTTCAAGATGATTGGGACGTCCATCTCGCCAACGCTGAGTTCGCTGTCAAC