Description :
From Genome Similarity Track
Location :
Scaffold_350:5703- 8096
Sequence
2393 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTAATGGATAGTCTTGTTCAAATCTCTATATGTGCTCTG
TGTACTACATGAATTTACTGATGTAAGCTACATAATTCTATTTTAACCAATCGAAGCCGCCTTCGCTCCGCTCAACAGCCAATGGGAAGGCTCAAAAATA
CGAGCGTTTCGTGTGACGGACGGACGGACGGACACCGTGCTAGCATTGATAGCTTAGGACTAGCCGTTCGCCGCCGCTACGCGGCGGAGTGGCATGGTTT
GTTGTAGATGCGGTGGCCACGAATTTAAGTGCTTCGTGGTGTCGCGTGTTTTGTGAGCGTCGTTCACCCAGTAGATCTTAGCTTCGTGTACGTTTGGTAC
GCTTCCGTTACCCCGTACTACAGGTTGGATGTCATGTTCTACAGTGGCCGGCGCTCTTCCGTGATCTTCTTGGCTTCGTGGCTCCCTGCTCACCCGTGGC
CCATACTGCTTAGTGATTGTCCTGGATTTGTGAACTCATTCTCTCACAGTGCTTAGTGGTTGTGTGCTAGCCTTTTTGGTCTCATGTGCTCCCGTAGTAC
GACCCTCTTTCGTGGCTGCTAGATATTCCGTGTTCTCAAGGGTTTACGTGTATTCCACAGGCTTCGTGTCCATAATCATTCATGGTCGATAGCGTTCCAT
TTCCGGTACCCTCGCCAATGGGTGGTTTTCCGAAGTTTTTTGTCACCTGTGTGCCGCGCACCCCTTTCGTGGCTCCATCTACCGCGTTGTCGCGCTATCG
AGCAATCACAATGTGGCTATGCTGTCTATGTTATCGTGATTGCATAGTATATATGTTTTGCCAATGTTATCGCGCTCTACGATGGTTCCGTGTCCGCGGT
GTGCAATCGTGGTCTCCAGAAGCGTTTCCCCGCGATTTTGTGGCTGGTCGGCCGTCCTGGTAAACGTTTTTTAATGAAGTATCGTCCTCAGTGGTCCGGC
GATCTCAGGCTCTACTGTGCTATCGTGCTCAGTGGCTCGGTGACTTCCCGTGGCTGCTTGTTCTCCCATGTTTTAGTGGCTGTTCATCGTCCA