Description :
From Genome Similarity Track
Location :
contig_51:57018- 58222
Transcript NameFunction/comments
g8602.t1hypothetical protein

Sequence
1204 bases(100 bases per row)
ACCGGGATAGCACTGATACCAACCAGGACGAGCACGAAGATAGCGACACACGTTCTGTAAGAAACCTCGAAGTCGCGGAATGCTTGTAATCGCGTCACGA
ATCGTGTGGTTCTGCTGTTATTGTTTGAGGGTGGCGTCGGGCCATGGGTTGCGCCGCTTTTCCTCGTCATCACGGGTCAAGAATCTAGCACAATAAAGTG
GAGTGGGTAGCTCGCCCGAAATGGTCAACTTGACCAGTCAAGTATAATTAGCGGGTTGGTAAAATGACGTTTGTGTCAAGCTTCAACATCTCTCGTCTCG
AGTTTCTTACTTTTCTTAGCGGCTGGCGATACAATTCTCCCCTCAAGTTACATTTCATTAGCTCAGTGAGCTACTCTTCATCTTGTGAAAAACCGAGGAG
GCAAGGGAGTGCTTACGTTCACCCAAACTGCTGGCCGTTGTGAAACTGGAGCCATAGCTCGATGAGGATGAAAGGTAATAGTCAGACGGTGATGATGAGG
CTGAACGAAGCGATGGGTGCCCTGGCGGTGGTGGAGTTGTAAGGCTAGCACTTTTTGTCGGAGACAACGTAGAGACCATCGTCGGCGCGCTGGATGAAGA
CGCCGCCAATTCGCAACTCTTGCGGCGCTTCTGAACGCACCCAATGCACACGCGCACACTTGTAGAACCCACGTCGGGGAGCGCAACATCCATTTTCGGG
CAGCACTCAGAACAGCAGATCTCACCGCACAAACGGCAGTGGTGACGACGACGCGAAAGACCAAACTTTGCATCACAAATACGGCAACCTAGACGCTCAC
GATTGTGCACCCAGTGAGGCGCATTCACGAGGAGTGACTGTGATAAGCGTCGGCTTGTGAGCACCTCCTCCAGTCGTGCAATCCTGGCGCAGAGTGCCCG
AAGCTTTGCTCGCCGAGACGCCATCGGCAATTGTGCTTTCTCCAAAATCGAAGCCACAAATTGTACCTCTACGTAGCCGTCACGACCGCGAGCCTCGCGA
ACCATGAAACCTGTAGGCTGGAGGTCCGTTGGTTTGGAGCCAACCTCGTCCAGCCACGGCTGGCAGTGTGGGCTGTAGCAAGATTGCAGCGTGCGTACGT
ACATCGGCGATGGATCAGCACTGTCGTCCCAGTCGTTCACCAAGAAACACTCGTAATCTAGGAGGCAGTAAGTAGTCCGCGACGCGAACATTCGACTCGA
CTTT