Description :
From Genome Similarity Track
Location :
Scaffold_47:57016- 62688
Transcript NameFunction/comments
Phyke_g2400dual specificity tyrosine-phosphorylation-regulated kinase, putative
Phyke_g2401methylosome protein 50, putative
Phyke_g2402hypothetical protein PHYSODRAFT_328708
Phyke_g2403hypothetical protein PHYSODRAFT_326166
Phyke_g2404hypothetical protein PHYSODRAFT_354941
Phyke_g2405mediator of RNA polymerase II transcription subunit, putative

Sequence
5672 bases(100 bases per row)
AAAATATACTGCTTGAAGCGACGGTATTAGAGGAAAATGCACGAAACAGTGGCGACTTGGGCAATGTGACACTCATCGACTTCGGGAGCAGCTGTCTCGA
AGGAGCCCCCATGTCCACGTACATTCAGAGCCGCTTTTATCGCAGCCCCGAAGTGTTGTTGGGCCATGCGTATACGGGTGCAATCGATATGTGGAGCTTT
GCCTGCATCTTAGTGGAGTTGCACACAGGCCACCCGATCTTTGCCGGCGAAAACGAACGCGAGCAGCTGGCTTGCATCATGGAGGTGCTGGGTGTGCCTC
CTGCAGAAATGGTTCGTAAAAGCAACCGCCGCTTGAATTTTTTTGACGAAGTGGTGATCCCCGTCGATAACCAAGTCACGGAATACGTCCCAAAGCCATT
CGTGAATTCGCGTGGGCGTCGTCGCACTCCTGGGCCACGCAGCTTGGCCACAGCAGTAAAGTCTGAGGACCCTGAGTTCCTAGCATTTTTGGCCAAATGT
TTTATCTGGGAACCTAGCCAGCGCATCACGCCCGAGCAGGCACTTCAGGAGCCTTGGCTGCGTCACCACGTGGACGGACAAATTGTCAATCCTGTAGAAT
ACGAGCTATAATATATAAATTGAAATAAGCGTACAGGAATGAGCAAGCGAGTTTTccgacagcttcagcaacgcGTTAATGGTGTTATACTACCGGCACG
CCCGgcggtgctgcaggaatGCTCACCCCCGAGGCCCCCGGCACAAATTTCGAGGTTGATGTTTCAGGCGCGGTGTAGTCTTCGACGTTCCACATATGCA
CGCTTTTATCCCAGGAACCAGTGGCGAGCAGCGTGTCAAACTGCTTGGTGTTAGAGGGAGTCGCCGATGCCACCTGCAACCAGTCAATAGCGCGCACGTA
GTCGTGGTGTGGCGCTGTGTGCTCTTTGCCAGCACGCATCTCGCGGATACCGCTGCCAGCAGAACGTGAGgacgagaagctgtcggttGTCACGAAAGCT
TTACCATCGTCACCTCCAGTCGCCAACAAGTCATCGTGGTAAGGAGAATATTTCACAATGTGCACCGCAGCTCTATGCGTTTCACGTCTTGCCAGCGGCG
TGTGCGGTGAGCGCACATCAAAGGTGCACACCATGCCGTCCTCCAGACCCACAGAGAATACGGTAGGCTGCTTCGGGTGCCAATCCACAGCCAGCGCCGG
CAATAGTGTGGACACCGCCAGCGCAGCACTTtgaggacgacgagagtCCCACACCTGCACCGTTGCATCCTGTGACGCCGAACACAATAGATGCGCGTGT
GTCGGGTTCATCGCCACATCCCAAATCAAGTCTGCGTGACCTGCAGACATCACCAACAGACCGTGTCAGTAACCTACATTACCCTCAAGTTCAATTCCAT
CCAGTAGCATACCTTCTAACGTAGCCACCGTCTTGTCCATAGAAGATATATCCCAAAGCTTTACCCTAGTAGCAAGGTCATCCAGTCATCCAGTCAGTCA
GTGCATCACTCGTCCCAAGTATGACAGCTCAAGTCATTTAGTTATTCACGTACGTGAGATCCCAACTGGATGTTGccagctgcgtcttctcAATAGCCGA
AACACTGATACCCGTAACAACATCGTCATGTCCCCAGCCGATtgaagcttcttcagtaGATTTTCCAGCCGCGCTGTCTGGATCGAGGGGCACGAAGGCG
AACGCCACGTCAGTGGAGAGTCTGGCAAGTCTCACGTCTCCATCGTCGCAGCCTAACGCCAGAATATCTCCATCTGCACCACACCAAGCCAACGACCCCA
CGCCAGTCTCcagttgcagctcacacaGACGTTCGCTAGTGGTTCCATCCAGTAGAGCGACTCCTCCACTCCAGACGTTGCCCTCGAGCTGCGATTGGgc
cacagccagcaacgGTAGCTCCGGCTCTTCAGctccgtcttggtcttcgtCAGAGAATAGTGCGCTAGGCAGAGAGCACGCGGCGAGGGCGTCCACTTGC
GCAGCCGCAGAGAAAGCAGGATGCTGCTCGGTTGTCATGATCTCTTGACTGGATGGCTCGAAAGTGTCAATATACTTTTAATTTTGCAAAATACGGTTTA
TTTTGCGTGAAATCTGTGACATGGTACAGTTGAAGTGGGTATTGTAACTGTGTTTCATCGCTCTTGTGAGCTGTTTTTTTTAGAAATCGTTTTTGTGAGT
TTAATTGTTTTGGTTTTAGTATAGCGATCTGCCACAAATTAAAGAATGAGAATGCATGTCATTTGACCTGCTTGTCATTCGACAAGTCGCAGCCATGGCA
CACGATCGGACGCGGAAGACGACCCAGGGACccattgccaagaagctgtgAACGACATCGTATCGGATATCGCGCATGTGTCGACGGAAACGAAGAGACG
GCGACCAGACGTGACTGCACGGCATGAAACGAACGTCAACACAAACGTGAGTGTTGTCAAGACCACGCTCAAGTCACTCTGCATGGAACAAGCCAAGACG
TTGCCGTGGAAGTGTGCTTATCGACTGTTTCAAGTGGAAGACGTCTTGGTAACGAGCAACTCTAGCAGTCGGTCGTGTTATACAATGAGTGGCGTGCTGC
AGACGTTGGCCGTGCAAGTAACGAGTATATAgctcgtggatggcaacacaACGCAGCTTTGTAGATGGAAACCAACTCTAAGAATGCTGTCAAGCTCAAC
TTTTGGAGACGGTTCCATAAACAACCCAAGCACTGTTACGATATCAAGGGAGGAGAAGCGTACAAGATGTCGAAAAGCATTCTTGGTCCAGTCTACGAAG
GCGacaatgctgaagtgctgGCATGGCAAGAATGTATCCCACGGATACGCAATGACAAGCTTGATGACCAAGCACATCTGCTTCTTCCGTTGCCGTACGT
GTTCCTCTCCGACATTGAGGAATGGAACCGTCGAAATCAAGCAACGCCTAAGTTCAAAGAGATCCGTTCGTTCAGTGTACTCCCGTTCAAGAAAGGTTTC
GAGTGCAGTCATTTCACGATGTGTAACCTCGGTCTTCGTGCATTGTTGAAAAAAGCTGGTATTGCTGTACCCGATGAAGACGTTTGGATTCCAGAAGCGG
GCACGTGATGGTGCAAGCTCTTCAATGTCAAGAAGTTCGAAACAACCAACCGGAAGTTTGCGGCCATGATTTTGACAGACGACAAGGCaatcagcatcgt
catgcGCAAGTCGAAGCGAGAAATTGTCGAGCGACCGCTGAACGAGAAAGACTACGACACCATGTGGGGTCTAGATCCTGTTCGAAAAGATTTGTTTGTG
GCGACGAACCAGTTTGGTGAGAAGATTTGTTGTTCGACACGTGAGTTCTATGAAGACGCCCACTACAAGAAAAGCGACAACAAAAACAGAATCTGGGAAG
TCAATTGTGCTGACGTTCTCGAAGCCGTTCACAGCAtgccaacgaagaagactgcATCGTTGGACCGTCTGGAAGAATACGTCAAGTGCATGATCCCACG
CATGGATATGTTGCTGACGTTCCGAATGACGAAGTCGCTTCGTAAACTGAGATTCCGCCGCTACAAgctcacgaagaagaagctgtgaGAACTCTGTCTG
AAGTTGACTACGCAAGCCGAAAGACGGACGATCGTCGGCTTTGGAGACTGGAGCAACAAGGACGCTGGCGGGTTGATCAAGAAGAGTCCGGCAGGTCTGG
TGAAGGGGTTTGAAAAGGTACTGAAGAAGTATTGCGGGGTAGAACCCATCGACGAGTTCCGAACCAGTAAACTTCATTCGGTGTGTCATTGCGATATGAG
AAACCAGTACTGTCGACGTGTTTGCAAAGACGGCATCGAGCGTACGTTGAAGGTTCATAGTGTACTCCATTGCACCAACAATGGCTGTCACGGTATGACT
GTGAACTGAAACGCAGACACTTCGAAGAACATGCTGGTGCTTCTCATCGAGTGGAAGATTCGTGGCCGTTCGAGGCCACTTGCGTTCCCCAGACCGGGGT
CGTGAGAATATGGCAAGTGTCCACGAGTGCCTTGGCGCAGCAATGTGTTGAGGAGGCTCGTAGCAATCTCCCTAGGATAGCCTGCTCAGGTTTTATTGTC
TTGCTTACTGGGGTGGGTAGGTAGGCGCTAGAATGTCGGGAGAAATTCTCATTTTAGGGGGTGACATTCTCGGTGGAAAATATAATAAATGGATGGCACC
GTTAGAGTCTTCTCCCTTCTCAATGGCTTTTGATGGAGTTTTAACCTGCCGTTGAACGTTGTCGCTGTTTCCTCGTCCCAAGGCCGATGTCTGGAAGAAC
TCATCTTGGCACTTTTCAAAGAGAAGGGCAGTAACCAAGTGACTTCGACAAACAAGAAAACTACGAACCGTTAACATGGCGAGAATGCCCACGAGTATGC
CCAAGGCGTCCCGTATTAAGGAGCATGGAGCCAAACAAGCAGCTTCCGAAACGGTGGATGAAATGCTATCGGAGGCAGAAAAGATGCGGCAGCGTCAAGA
TGTGGAAGACGGCCTTCGTCGCACATCGGAGCAGCTCAAAGAGGATGTTCGCAACCTGAAGGAATACGCACAAGACAAGATGGGTCAAATGAGCGACGTG
GTGCGGGATGCAGCTGAGTCGGCACGCAAGACCACGGGGTTCTCTGGCGGAGCAAAGTCTCCTGCTGTGCCTACAGACACTTTGAGCGATTCTGTGATGG
AATCACTCAAGACGGCGAGCGAGCAGCTCAGTGCAGAGATCAGCGATCTCGGTGAGCGCGTGGAGAGTGTCAAGGCCCGAGTAAGCGAGTCGatgcaagc
tgcaggaggacGCGCAGCGAAGACGTGGTATCAGAGTTCCGAGGCCGCGAAGAACGTCGGCGAGCGTGAGTACTGCCTGCCACTGCCCACAAACCGCATT
TGTGCGCGGCACGTGGCATTCGTCGCCATCCCGCTACTAGTAATGCTGTTGATGTTCATACTCCGTCGTCGCTACCCGAAGAAATGGAACGCTGGCATCC
ACAATATGAAGCAACCACAAGCGATGTTGTCGCACGATACCCCGGCTGACGAACAACTACAAGACCACGTTTCGAAAACGGCCGGCACCATCCACAATAA
AGCCGAGTACACGAAGCAACGTGCCGGTGGACTCATGGGGGAGATGCACAGTCAGTATGCCAAGACGGATAACAAGAAGGACCAGTAAGcttggctgtgg
tggtcATTGATGGTGAGGCTCATCAGCCATCTGCGAGCGGGTCCGAAGGAgttgtcttcttgctgatgGGTGCAGACAAATTCCGTAGCTGAGTGCATAT
TTTATATTCACAAGTTGGGAGAGCATGAAAACAGAGTTGTTTTGATGCATGAATTACGCAACTTTCTGTCGCTTGgcaccttctgcagcagcctcattCT
CGCGCTTAATGGCGCCCGCCTGCTCTTCtccacctgttgctgctcctgctgcagcagtgttgttcatctccagcttctcggCGATCTCTGGTGCGTGCTT
TTTCATCAACTGGATCAGAATCGAGTCCACACGTGCCGAGTTCTCGCGCtgtttctccatcttctcgTATTTTTGCTTGAGTTTCAGTTGCAGCTCTACT
CACAAGCACAGAGCACCACAATAGTCAACACACCTCCTCATTCATCACACACGAACAGCCACATTCACTCAC