Description :
From Genome Similarity Track
Location :
Scaffold_24:57016- 58305
Transcript NameFunction/comments
Phyke_g1564hypothetical protein
Phyke_g1565hypothetical protein PHYSODRAFT_479752

Sequence
1289 bases(100 bases per row)
CACGCCAAAACCGCGTCAAGTACGCGGCAGGAGCCTCCTCTGTGGCCgtagcaggagcaggagcagaagTCTCAGCCATTGATACAAAGTGTGCGGTGGA
CGTTAATGCAATTTTCTGATTGGCTTAGCTCAATTTTGAGGTCTGAATTCTGACCGATAAATATAGTGGGGAAAAGGAATAACACTATGAACTCTCCCTT
AAACGTGTTGATTCGTTTGTCTCGCTGCTTAGACATTGATTCCCGTTATTGCTTTGATCCTCATGTCGTCACCAACATTTGCAAACATATCACCAACGAA
ACCAAAGTTGTTGCCATTCGCATCAACCACAGACTCGACTTTACATCGTCCAGTTTGGAGAAGTACTCGAGCCGTCGAGCCATCCCCTAGAAGTCCTCGT
AGGGTGAGTGTATATACCTTTGTTTTCACAATTCCGTGCTTATTTCGTCTTCGGTACGCTCCTGTTTTGTGGTTGGCAGCCACCGTCTCGGTTTCGAGGT
CAACTTCGGTATGATCTGTTAGGGCCCCCAATTCGTCCGGAACCGATAACTTCTCAGCCCCACAATCAGCACCTGGCCACCTCTTGTGCTCCCCCTGAGT
GTCCGGTTTATCAGGCTCCAGGCGACCCAACCAAGCTAAGTGAGGTGGTGCCACTCGATAGAAGAAATTTGTTCACCAATCTGGAGGACTTGCGCTGGCT
GGAGCATCAGTGGCTTGACAGACAcggcaaaagcagcaacCTCAAGGCAACACGCGAGCAATTGGCGCTCATGCGTCGATGGTTTGACTCGCTCGACACT
GACGGTTCCGGCGAGGTGGGTGTGGCTGAACTCGAGGATCCTCTTGTGTCCGTCGGCCTGGCGTGCAATCGAGATGACGTTCAACAACTGATTGAAGACG
TTGGTCCTAGTGACTCGGGTGGCGTCACATTCGACGCCTTTTTGAATCTGCTCTACCCCGAGAGACTCAAGCACGATCGGAGACCGCGGCTCCCAGTGCC
ACTGGACACGCCCAAGCACCGATCTCCAAAGAAACCTGTAACCTCGCCGGTGGTCTCAAATACACCGAGAACTAGTCCGAGATCAAAGAAGCACCCAATT
CAAAGCGTCGTGAGCAAAAATGCCAACCCGGTTGCACGGTTATTCGAGGATCTTCAAGAAGGCAAACTGGGCGATCTAGCCATCCCATTCCCTGTATTGA
TCACCGCCTACCGCCGACGTATGCTCCTCGATGCACACATGGCAGAAGACCCCACATCCAAAAGGTACGCGTGTGTCTACCTAGCAAAA