Description :
From Genome Similarity Track
Location :
scaffold_25:570024- 572210
Transcript NameFunction/comments
Plaha_PHALS_13729mitochondrial substrate carrier family protein
Plaha_PHALS_13730hypothetical protein

Sequence
2186 bases(100 bases per row)
ATGACGACAAAAGCAAGAGCAAAAAAGGAGGATTCACTTCAAGTGAGAGCACGAGTCGAACCGCAGTGGTCGCGTCTTCTTAGTGGCGGTGCAGCATCAG
CCACCGCTGAGCTATTGACGCTGCCTATTGACATCACTAAGGTGCGTCTGCAGTCACAACGCTCTGGATCCGCGTCAGGAAGTAAAGCGGTGACGCACTA
CACAGGCATGCTCCATACTATACAGACAATGATCAAGCATGAAGGTCTCAGTGCACTATGGAATGGAGCCACTCCTGCTTTGCTGCGTCAAGTTTCGTAT
ACGAGTATCTGCATGGTGCTCTACGAACCACTGCGCAATACCTTTGGAGCCAGTGTGCACCACTGTGCGAATGGTGAAGTGTCGTTCATGAACAAATTTT
TAGCCGGTGGTTGTGCAGGAGCTATTGGGATCAGCATTGCCAACCCGTGCGTTGAGATTTCTCTCTTTCACTGAGCTGGCCCATAATCAGGAGTTTGACG
AATATCTGATTTGGTGTTTTAGTGTAGACGTCATCAAGGTACGAATGCAGGCAAACCGCTCCGGCAAGCTGTACAGTGGTGTTGGAGACGCCTTCAGCGT
CATTTACAAGAGGGAAGGTTTCCGTGGGTTCCTGCGTGGTATGTCGCCTAACATCAAGCGTGGCTTCGTCGTGAACGCTGCTGAATTGGGCACTTACGAT
CATAGCAAGGAGCTGCTCATTTCGTCTGGATTACTGAAAGAGGGTGTCCTTGCACATACTGGTGCGAGTTGTGTGGCTGGTTTAGCCGGCGCGTCCGCTT
CTAATCCGTAAGTCTTTCGAGGCATCTTACCTACAAATCTTCGAAATTGTCTTATCTTGTTGATGTGGATAGAATTGATGTGGTAAAGACGCGTCTCATG
AGCCAGCCGACCGATGTGAAAGGCAAAGGGCTTCTTTACAAGGGTATGATAGATTGCATGCACAAAACCTTTCTTGAAGGTGGTGCAGGCGCTTTCTACA
AGGGATTCATTCCCAACTGGATGCGCAAGGCACCTTGGTGCATTGTCTTCTTCGTCACGTACGAAGAAATCCGTTCCATGCTCACGCCTAGTAACGACAG
GTTTTAAATTATATAATATATAAGTATTGACACTAGAGTATTTAGTCTCTGAGAACATATGATTTGAAGAATAGTTCTAGCTACATACAGCTGGCAACAT
GCTCGACATTTCTGATAAATAAGAGTACATGGCCTTTTTAGAAAATTTAGTGAAGTCGCTGCGGTGAGGTGATCTGTGGAAAGCTTCCGTTCGCTTTCCT
TAACGTATTTCTTGGATAGCACAATATGTGCCTTTAATCCCCAAACCACCACTTACACAAGAGGCAGCTCGAGGCGATAGAACAAAATAGAATTTTAGCA
CTTTAGTGCCTCAAAATCATGCATCTGCATGTACCACGTCGAGCGGGGCGGTGTTAGATAGTGCATGGTAGAAGATCCATTAGGCATATTTCTGACAAGC
GAGTCACGCAGATCAATATATTCGTCAGTCTGCACGACGTAAATCTTCTTATTGTCAGTTGGAATTGCATGCTTCCCACTCTTTGGCAGCATGACAATCG
GCAAGCGCTCAAAAACACAATCCTCTGTCCTCCACCGATCACGCGAAATCACGTGAACATTGAAAGCCGAAAAAGAACCGTTCATAAATCGATTCGAAAT
TGTGCTCTCCACCGAAGGCGCCATGACCTCTTCTTCCTCATCCTCTTCAGAGAAATAATTGGCTGGTAATGTACGACGACGATGTGTGTGATGCCTCACA
TTGTTCTTCGCAAAAAGTGATCGACGAAAACATTCGCGCTCTTGTCGCCGGCTTTCAAGCAATTCGTCACGTGACATGCGCGTCTGATTCGCGATATCAT
TAACCGGCGCTACTTGAGCACTGCTGTTGCTACCTAGGTAGCTACCGTTGCTGCTACTGTGGCTGCCTTGATTCGAGCGCTTCGAGCGATTAAGCGCTTT
TAACAGCTTCTGCAACGCCACAAACGTTTCGTCCACTTCTTCGTCCTCAGCAGAAAGACTGGGGTTATCTTCCTCAGACACGCTACCGGTATACGACAGC
CTCTTCTTTGGCGTCTTTTTGCAGGTTGCCATTGTTGTCTCTTGTTGCCAAGGAAAGCTGCGAGTCATGCAGCAAAATACGATGTG