Description :
From Genome Similarity Track
Location :
Scaffold_2147:570- 3146
Sequence
2576 bases(100 bases per row)
CTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGCGAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGA
ACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATTCCTT
CTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCT
GGAACCAAATACTGCGTAACAAGGCAATAACCTTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTG
CGTGAGAGTAAGTCTTCGCACTCGACACCCACGTTCTGTGTTAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCA
CTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCGATAGCTACTA
CCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAAC
GCACCAGCAACGTTCAATCGTCTTGGGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCTG
AGCACGGAAAGTCAGACGTGGAAAACCCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGATAAGTGCG
TCTTTGGCGCGGAGGAAATACCTTTCCTCGGGTGCTTCATTGGGAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGT
TCCCAAGAACCAAAAGGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAATACAGCGCGAACTACACGGAGATGGCTCGGCCATTATCAAAT
CTCCTTAAGAAGGACGCACCACGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGAGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTAC
CGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGAT
CGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCTAGTTCATGACAAAGAGTTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTA
CACCTGCTAGGCTCTAAGCCTTTTGTGATATTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCATGATGTC
TTTCCTTCTTTGGCGAATATAACTTCGAGGTGAAGTACAGGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGC
TCATGTCACGACAGTGATGTCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGACGCCATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAA
GGGTTTAAAGACTCTGACAAGGAGTTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGGTGGCGGCCTGCTGTACTACAGCACCGACTCTG
AGGATAACCCTCGTGTAGTCGTTCCTCATGATCAGGATCTAAAGTATCGAATCCTCTATGAGGTTCACGATACGCCCGTGGGCGGGCACTTAGGTCGGGA
GAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGGACAAAG
TCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCGCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTATGGCCTTCCCAAGGATA
AGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTT
GCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCGTC
AGAGTGCTCGGAACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCAAA
GCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTT
CTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGGTGGGGGAGGG