Description :
From Genome Similarity Track
Location :
Scaffold_1483:570- 2375
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1483-snap-gene-0.3Nucleic acid binding protein
Pytar_ATCC12531maker-par_contig_1483-snap-gene-0.5Conserved gene of unknown function

Sequence
1805 bases(100 bases per row)
ATCCAGCGACCAACGCGTTCAAGTGCCGCGGCACACTCGACGGCCACGTGCGCAGCGTCACGCGGCTCAAGACGTTTGTGATTGGCACGACGCCCATGTA
CGTTTATCTATTCTTCTAGTTTCATAGTGGAGAGAGTACGTCGTGCTGACGATCTCTTGTAGTCTGGCGTCGGCGTCGGTCGACACGACCATCCGGCTCT
GGGATTTATCCACGTACCAGTGCGTCAAGGTGCTCTCGGCCGACGACAATGGGCACACAGACGCTGTGATGGACCTCGAGTTCTGGGTCAACAACGGCGA
GACGTTTCTCATCAGCGGCGGCTTGGATTCGGAGATTATCGTGTGGAGCATGGGCGGCCAGTTCCAGCAAGTGTTCAAGGAGACCCAGGACGCGCAGGTC
ACGGCGCTTTGCGGCACACAGGATGCCGCGCAAGTCGCACTGCTGCTCGTTGGTACCTCGGTGCGTGTGGTCACGTCAAGCCCTTCGTGGCAATAGCGTA
TTCACTGATTTGGCTTTTCTGTCTCTTCCAGGATGGTGCGATCACGGTCAAGGAGCTGCCGACGTTTGCGTACAAGACCACCTTCAGCGCCGGCGCCAAC
TTTGGCCACCAGGACGTCGTGCGCCGCATCACCACGGGCCCACTCAACACATTCTTCAGCGTCGCCAGTGATAGCCGCATGATCGCGTGGCAGATTGTGG
GCGACGCCAACTCGGTGCAGCCCAAGTAAGAAACGGCAATGCTGGGTTGTAGTATCAGCTGATATACACCTCAGACAAATGACCGCCCCCCACATAAAAG
AGAGCATCACTGTACCCAACCAGAGCCAAGCATATTCTGAGATTAGAGCTAAGTTGCTCACTGCTCGTCGTCGTCCTTGTCCTCTATGAGGTCACGATAC
TGACCTGGATTTTCGGCCTCCCATTGCCTGATCCATATGAACGCTTTCACATCCCCTAGCGTGATTCTCTTCATGCGGAAGTACCGTCGCTTCAATGCAG
CGAGCGTTTCCACCGGATCGCACACGCGCCCGACGCGGACATAAGTCTCTAGGAACTGCCGATATGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNACATGCGATCGCGAGACGTGGAGCTTCATTTCCTGCAGCGCGTCGTGAACGTTGGCTGCCGACACACCACCAACCCAGTACTGCG
ACGATTTGGCTTGCTTGCGCATATAGCGTGTGAGAAAGGCTTCGTATCGAAGAAGTAGTCCAGCATGACCAAACTGAGCTTCGTTGGTACTCCACCGCTC
TTGGAGATATCTAAATACCTCTCGGACTTCTAGCCATGACGGGATGGTCACGCCTGCAGCCCGCAGATGGGCATTGAGCTGCTCTTGCACGTGCGGGGAC
GACGCCTTCGTTTGTTTGTATAGCAGCTCCTCGAGGATATCCGCATACAATGGTGCTGACACCGTACTCTCGCCGTTGGAGAACAAGAGACCACTGATCA
TGTTCTCAAATGATCTCTCCCCTGGCCCATAGTTTGGCTGCCCGTCTGCTTGTTCGACACGAACGGCTTCTTCCAGCGCATGAACGAGAGCTTGATTGAC
TGCGG