Description :
From Genome Similarity Track
Location :
Scaffold_1332:570- 1658
Sequence
1088 bases(100 bases per row)
GGGAGTCGAGAAGGACTCCTGTTGAGATAGTTCCTCGAAGTGGACGATGCCATTAAGGCTCTCCACATCGACGATGAGGAAATGCAAGTAGCATTTTCCA
GATCGAAATTGTCAGGCGTGCCAGAACTTGGGCCCTGAATCTTCAATCACACGATCCAAACGTGTTCGGATCGTTAGCGGTCTTTAAGACTCTGCTAAGA
CAAACGTTTGAGTCGCCAAGAGCTGAGTTCAGGAATCTTTCAGAGCTTCCGAAGATAAAACAAGGTAAGCGTGACGCTCACGCTTACGCTCAGCAAGTTC
GTTACCTTGCAAGTTGCATGGTAGAGAACCCTGTAAGTGAATTTGTGTTGATCACGACATTCTTACAGGGCCTCATAGATGGTCCTGTGAGGAACCACCT
ATTCCGCATCGAGTTGAAGTCGCTTGAGGAAGCGATAACAACTACGGTGCAAGAGAGCTTTAGTGTGAGACATGCTCACACTAGATTGACCCCCTATCTT
CCTTCGATACGAGTAGAGGCGGGAGGTCCAGAACCAATAAATCTATGCAGTGTCGAGAGCTAGAGACCTCGCTCTTCAAGCAGTAAGCGATTGCAAAAGT
GCAATCGCTGTCAGAAGTTAGGACACTACGTCTACGGGTGTAGTGCTCCACGCCCAGTGTCTTGTAACACTGAGCGAAGTAATCGACCGTCTGCCAAGAA
GGGCAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTGGCGGACCGTCAAAAATGGTCGGGGTCAGTAGGGGCGGAGTGCCCTAATGATCC
AGCAACCTCAATTGAATTTGCAAATCTATTGATGAAAGTTGCTCCAGACTCACAATCGTTGTGTGCCTCTGCACTTGGTGATGAGGGGTATCTAATCACC
TTGAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCGTCAAACAATTTTGTTCGTCGTCAGTCGCTAGAGGATCGTAGGC
TTAAGTTCGTTGAGCGTGTTACTCCTCCTACGAGGCTGACAGTGCGCCTCGCAACAGGCGCATCAATAGCAGTGATGAAACGTGTAGT