Description :
From Genome Similarity Track
Location :
Scaffold_143:57- 3964
Transcript NameFunction/comments
g8411.t1hypothetical protein

Sequence
3907 bases(100 bases per row)
TTGTACGCATGATGCGCCGAAATGAGAGATGCGCCAAGCAAAGCAAATGACCTCAGTTCACTATCAAAATTGAAAGATGCTGACTGATGCGTGGTGAAGA
GAGAGATATGGGGGGGATGGGGAGGACAGATTTTTGGACCTACTACAACGCCACGTAGGCTGTGTCACGGACAAATCGCACTTATGCTGAGTGTTGGTTG
ACGCAATCTCGCCCAAATTCGGACTTTACTGCATATTTTGCAGTGATGTTTGCCACATAATGCAAACTATTCAAGGGTTAGGGGAGACCGTCATGCCAGG
CAGGCGATGTGATTGGTAGTAACAAAAGTGGGTTGGAGCTTGGTTGAACTTCTGTCAAGGGGGTCATTTTGACCCCCTTCATGGCCACTTTTCTCGCAGG
TTTTGACTCGAGCTGTCCAGATACTTTGCTAATGGTGGTAGCGTCATGAAAAATCTTGCTGATCTCGTTGACATTGTTGTAGCAGCAATGACAATTCGTC
AGCAACATGCACACCATAACTAGCTTACCTGTATGCCTCTGGCGCAATGTCAACTTTGTTTTAGAGTCGATGAATATCCATCGTGTTATGACAAGCGCAA
ACATCCACTCCACGCTTTCCCCGTAGGCGTAAACATACAGTCCAAAACATACGGACAAAGATTGAGTTGAACGATTGGCTTGGCATGGGCCAACAGCTCG
CTAGTTTCGTGGTTAACTGCTTGCGTTCTTCGCTGTGCGATCGAGAGCTCATTTCGGAAAAAGGCATCCTCGGAACACACAACCAAGCTTGTCGGCGCAT
GAAGACCAAGCATACACGGCAACTCAGACAAGTATGTGGTGTAATTCAAACGCAACGTATATAAAAGAAGTACTGGTACTAATTGGCGAGTGCTACGAAG
TTCTAGGGCCGTATTATAGCTGCTGCTTCGGCACCGGCATGTTTGCTGTTACACTGTAATTCATGGTTATTATTGTTGTTTGATTAACTGTTGCGGGTGG
TGCAGAATCTTTATGTGGGTTACTAGCTAATGGACTGAAGCCTTAATGGCGTGGCATCACAGAACAGAAACTAAAAAACGGTGTCGCAGGTCTGTCCATG
TAACATACATGTAATGTTCTCATGGTGAAGGACAAGACTACCGTGTACGAAATCTTTCAGACGCTCTGTAGCAAATCCGAATGTGCTGCCATCCACGGTG
ACCCGTACTACATCCAGTCGTACCTGATGGCTCTCAAATACGAGGATGGGTCCGACCTCATCGCTTTCATCATTGACTTGGAAGAATCTATGAAGGCAGC
CGCGGAAGCCACGAACAGTGTACTGACCGACGCGCACAAATCGCTCTATCTGTTTCATTCCCTTCCAACGGAGTGGAAGCCTGAACTAGCAGTCTGGAAG
GGCAGTAGTAAGTTCATTCCGTACGAAGATCTGAAACGGCACATCGAGACCAAGGTCCAGAATGAGCTAACGCGCAATCGCTACATACTCAGACAAGGAA
CCTCAGAGTCTATAGAAACACGAGCTGAGAGAAAAGTTCAATCCACAGCACCGATTCCGATGCCAGCGGATCTGCAAGTCCCCGCCAAGATGGAGACAGC
TGTCGTGGTTTCATTGAAGTGCTCGTACTGCCAGCGCGACAACCATGACACAGTTGACTGCTACATCCTGCAGCGTCACCTACGTGGTGGTCAAATCAAG
GCTGGTACGGTTCTTCCCGCCAACTTTAAGCTCAAGGCACGCAAAGTCATCACCCTTACAAGGGCAACTACCAGGGAAACCGTGGCAACAACTCGTGGGC
CAATTACCTTGGTCGTGGAAACAACAATCGTGCTCCTAACGGAAAACGACAAGATCGCCGTGGAAGTCACAGCCGCAACAACCAAACAAAACAAAACGAG
TTTCACGGTCGGCGCAACCAAGACACCCATGGATCCGACAACAACGAGTATGGCATAATTGCTATTACAACGCTCGATTGTTGCCCGAAAACTGTGGAGG
TGGGTCTCACTGCTCATGTCGGACTCCAGGATTCATCATGGACGATTGATTCCGGCTGCACTCGCCACATCACGTCCAACAGGGAATGGTTTGTGACCCT
AGAACCGACCGCGGGCAAGTCCATCACGGTGGGGGGCAATCACCATATTCCCATTGCTGGAACAGATGACGTGAAGCTAACCATCAAAGATACGAAGGGA
AGATACCAAGTCATTACCCTGGTCAACGTGCTGTACGCACCTGATCTCAAGTTTAAATTGCTCTCGGTCCGTCAAGCTGTCGAAACGGACTACAAGATCA
ACTTCCCGAACACCAAGAAATGCGTCCTGTTCTACGACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAATGGCACTCGCTTCGACCAATTCGTAGCTCG
CCCGGTGAGCATCGACCACGCAGCCCATGTGGCCAAATCTGGTACGTCCGATAATATGTTACTCTGGCACAAACGAATGGTTCATCCTAACTTTCGTATT
ATGCGGGATCTGGCTAAGTTGGACGCCATCACAGACATGAGGATGTCGAAATCCGACTCAAGCAAGACTACTTTTGCTCTTCATGCACATACACTACGGC
AAGGCACATCATAACCCAGTCAATAAACGTACCGTTGAAGGGCAAAATCCCCTCTTGAAAAGGTTCATACAGATATGGCTGGGCCCCTTCCTGTGCCAAC
ACTATCAGGCTGTCAATATTTCTTGACCTTTATTGATGACTACTCGCGCAATGTGTGTATCTACGTTATCAGGCGCAAGTCAGACCTGTACGTCTGGTAC
GAGGATTTCAGAAAGAAAACACAGAACATGTTTCGCGCTGATGTGGTTCACTTAGCATACCATGCTGACATGCACGATGAAGAGATCCGGAGCCTCCAAA
GTGACAACGCTCGTGAATATGAGAAACTCGGGAGAATTATCTTCGAAAAATATACACACACACACAGTTCATAAATGCATACACACCACAACAGAATAGC
GTGGCAGAGAGGCGTATGCGCACACGTCTTGAAAGAACGCGAGCATTTCTGGTTGACGGAGATCTTGCCCAACTCCTTTGGGATGAATGCAACACACACG
TCGCTGATCTCCTCAACGTGACCCCGAGTTCGGTCACAAACAGCGTTACCCCCCCCCCCCCCCTATGAAAAATGGTTCAAAAAGAAACCATCAGCACATT
ACATTAAAGTGTTTGGCTGCACGGCATACGCTCACATCCCAGAGCTATACCGCAACAAACTCGACAAAAGGGCTAGAAAATGCATGTATCTGGGAATTCC
ATCCGACAAGAAGGGCTACAGGCTCCTAGATACGACAGATAATCGCATTGTTTACAGCCGTGATGCTCCCTTCCGCGAACATGAATTCCCCACGCTGGAT
TTTCTCGATTTACAGAAAACAACATACTTACTTAGTCCTAAAGCAGGCACTGCAATTATAGTACCAGCACCCAATCGCTTGCCCTCGCTGCCAGCAATGC
ACTTGCAGCTGAAAAAACAAAACCAACACCTAAGAAAGCAAAACCTTTCTCAGAAAAGAAAGCACATACACTGATCCAGTAACAACTTTACTAAATGGTA
CTCTCGATCTAGAGGAACGCGAAACACGTCTCACTGCCCTCTACACACTGCTTGACATCAGGCATATATCGAAGCCAAAGACCTACAAGGCAGCCGTGCA
TCTGCCAGAAGCTTCTCACTGGAAAATAGCCGCCCGATCTGAGTACAAGGCTCTCATGGACAATAAAACGTGGGTAACTGACCAAGTTGCCTAATGGCAG
ACGTGCATTGCAATGCAGGTGGGTATTTATCGTCAAATACAAAGGCGATGGCACAATAGATCGCTACAAAGCTCACCTAGTTGTTAAGGGTTTCCTTCAA
AGATACG