Description :
From Genome Similarity Track
Location :
Scaffold_1693:57- 1869
Sequence
1812 bases(100 bases per row)
GTTGTGATAGCAGAACTCAACAATCTGGAAAAAATTCGCTTCCATTTGGGAAAGGATTGGACGTATTTTTGAAAGATTCTTTTGAAGGACGCGGGTGAAG
CGTTTTGATACCTTGGAACACGGGATGCCAAAACGTCGCCCTGAAACCGTGGATCTTTTTTCAGAGATTAGTTCCCGGGGTAGACCCGTGGAAGTTGGAA
TACCCTTGTCAATGAAGAACCCGGGCACCAGCCCAGGTGGTGAGATTGACTCTATTAAATGCAGCCAAGGATGTACCCTTTTGGTGAATAATTTTTCGAA
CACAAGAATACCATTAATTTGGGGGATTTTTTTTTGGGAGAAACCGAAGGAGAAGTCCATTGAAACAAGACTACCAGCACTTTGCCGGGATTGATAGAGG
CTGTAGTGGCGCACGCGATGAAGAGACTAGGCTTCACCCGTTGGCACACTTCACAAGCACAAATTTAATTGCGAACAAACTGATACTGGCGGAGCCAGTA
AAAGTCGCGACTTACCGTGAGATAAGTCTTCTCACGCCCACGATGCCCACTAGGTGGTGCATCGTGACACTCATACATGATGCGTAAGATCAAATCATTA
TGAGTGGGGACGACGAAACGAGGTGTGTCGACGGTAACGGCTGTATAATACAGCAACCGTTGCGTGTTGTGTATTGATCCGCGGAAGATTGATACAAGGC
CGGTAAATCTTTGAGAGATTTACGAATTACATTAGTCGCAGACGAGCCTTATCTTGTGCGTAAGCCTTTCTGATTTCATCAAGAAATGTTGGCGACGGAA
AACCAGCGACTAGTGTTGCAACAGTGGTATCAACCCCACTGGTGGACTGCGCAGCCGACTCGAAATCGGGTCGGCGCGACAAAGCGTTCGCGACGACGTT
AAGCCGTCCGGGTTGTACTCCACAGAGAAGTTGTACTCCGCAAAGAAGGACAGTTACCCCGTCATAATTTGCGAGAGGTGTGGACTTTTTACGGCCGTGC
GTAATGACGCATGGTCCGTATAGACTACAAACGGCCTATCTCCAAGGAGATAGACGCGAACTTCGCTAGTGCATACTTCATGGCAAGGCGTTCGTTGTCA
TGTACTGGATAATTACGCTCAGATGCTTGCAGATGACGCGATTGGTAACAGACGACACGCCCTACGCCGTCTGCATCGTACTGCATTAACGCGTAGCCGA
TCGCGAAATCGCTGGCGTCACAGACCACATGGAATGGTCTGTCTTGATCTGCAATCGTCAAGATGGGCGATTGCATCAAGCTCTGCCTGATATCTTCAAA
GGAACGCTGACAATCAGCGTCCAATGACCACGTCTCGTTCTTCTTCAAAAGCTTAGAGAGGTGAACAGTCATCTCAGCGTAGTTGCGCGAGTACTTGTGT
AAGTACGCCGCTAGACCAAGGAACTTTCTCAGTCCCTTAAAGTCGACTAGCACAGGCCAGTCGGTAATCGCCTTGATCTTTTCGGGACCAGGGCGTACGC
CGTGTTTACTCACGATGAATCCAAGAAGTGGTATCTCGCTAGCAGCGAATATACACTTCTTGAGGTTGGCATACAGCTTATGTTTGTGCATAAGTGTAAG
AACCTAGCGAGCGTGAGTTCTATGAACCTCTTCGTCCGTCTTTCCGGCCATAGCCCGGCTATGGACGAACACATTGTCGAAATAACTCGGTGCGAAGTCT
CGCACCGATCTCAACAGATTTGTAACACATCTGTTGAACGTTGCAGGAGCGTTACTCAGCCTCTGTGGCATCACCAGCCACTTCCAGAGCATACCGCTCG
GGGGTGCTTACT